header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-803
Transcript Name: stx3a-203
Previous Name: stx3a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060914 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060914|OTTDARG00000027947|ZDB-GENE-040426-1489 stx3a|OTTDARP00000047072 stx3a-002 LG_ CT955967.12 Danio rerio protein_coding KNOWN, 1275 bp
CAGAAATATGAAGGACCGACTGGAACAACTAAAAGCGACG
TGCGATCATGATGACGAGGATGTTGAGATCGCGGTGGACA
ATGCTGCTTTTATGGATGAGTTTTTTTCCCAGATTGAAGA
CATTAGAAACAGCATTGATAAGATCGATGAGAATGTGGCC
GAAGTGAAAAAACTTTACTCCGTTATTCTTTCTGCACCAA
CGTCAGACCAGAAAACACAGGATGATTTGGAGGCATTAAC
TAATGATATCAAGAAAATGGCCAACAATGCTCGGAACAAA
CTGAAGACCATTGAAAGGAATCTTGAGACGGAAGAAGTGG
AAAGAGTATCGGCCGACATGAGAATACGTAAATCACAGCA
CGCTGTTCTTTCCAGAAAGTTTGTTGATGTCATGACCAAA
TACAATGAAGCTCAGGTGGACTTCAGAGAGAAGAGCAAAG
GTCGCATTCAGAGACAACTAGAGATCACCGGTAAAGCCAC
AACTGATGAGGAGCTTGAGGAGATGCTGGAGGGTGGAAAC
GCAGCCGTTTTTACAGCAGGGATTGTGGATTCAGGGATCT
CCAAACAAGCACTGAGCGAGATCGAAGCACGTCACAAAGA
CATTGTGCGTCTGGAGAGCAGCATAAAGGAGCTGCACGAC
ATGTTTGTGGACATTGCCATGCTAGTGGAGAGCCAGGGTG
GCATGATTGAAAGGATCGAGAACAACATGGACCAGTCAGT
GGGTTTCGTGGAGCGAGCCGTTGCTGACACCAAGAAAGCA
GCTAAATTTCAGCAGGAGGCTCGGCGTAAGAAAATGATGA
TCATGCTTTGCTGTGCGATTCTGGGGATTGTTGTGTTTTC
TTACCTTTACAGCTTCTTTTCATAATGGCTGAAGTGACCA
CAAGGACTCCTGCCCGTCCTCTCACATCCGTGTTTTGAAG
AGATGCGTTTACTGTGTAGTGTGCTTCAACCAAACGAACC
CTCACACCCTATCGAGTGACTGAAACCAGCGCCCTCTGCT
GTTCAACAACTTCATTAAACAAGGACAATTCCTTTCAAAA
GGAGCCCGGAGAGAGACAGACATGTCAATTTTTTTCGATG
TTTGTTCTAGTTAATTTTGGTAGTTAGTAGATGTAATTTC
GTCTCATAGTCTAATATGTTTGGTTGTATGTTTTAATGTT
GAAACGAGTGTTTTTAACAGTAGTATATACACTTAGCCTA
TTTTGAATACGTCAATATGGTATGGTTGTCTTTAATGTGT
TATGTTATCTAATAAAACGAGACCACAAGAAAAAA

stx3a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA stx3a-003 (1) 227
mRNA stx3a-201 (1) 2051
stx3a-203 1275
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
stx3a-203 Contained in:
OTHER stx3a-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060914 (1)
  • Ensembl_Trans:ENSDART00000169942 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:GU189280 (1) 1139bp
    GenBank:CR930298 (1) 539bp
    CITATIONS (2)