Transcript

stx3a-203

ID
ZDB-TSCRIPT-141209-803
Name
stx3a-203
Previous Names
  • stx3a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060914 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060914|OTTDARG00000027947|ZDB-GENE-040426-1489 stx3a|OTTDARP00000047072 stx3a-002 LG_ CT955967.12 Danio rerio protein_coding KNOWN, 1275 bp
CAGAAATATGAAGGACCGACTGGAACAACTAAAAGCGACG
TGCGATCATGATGACGAGGATGTTGAGATCGCGGTGGACA
ATGCTGCTTTTATGGATGAGTTTTTTTCCCAGATTGAAGA
CATTAGAAACAGCATTGATAAGATCGATGAGAATGTGGCC
GAAGTGAAAAAACTTTACTCCGTTATTCTTTCTGCACCAA
CGTCAGACCAGAAAACACAGGATGATTTGGAGGCATTAAC
TAATGATATCAAGAAAATGGCCAACAATGCTCGGAACAAA
CTGAAGACCATTGAAAGGAATCTTGAGACGGAAGAAGTGG
AAAGAGTATCGGCCGACATGAGAATACGTAAATCACAGCA
CGCTGTTCTTTCCAGAAAGTTTGTTGATGTCATGACCAAA
TACAATGAAGCTCAGGTGGACTTCAGAGAGAAGAGCAAAG
GTCGCATTCAGAGACAACTAGAGATCACCGGTAAAGCCAC
AACTGATGAGGAGCTTGAGGAGATGCTGGAGGGTGGAAAC
GCAGCCGTTTTTACAGCAGGGATTGTGGATTCAGGGATCT
CCAAACAAGCACTGAGCGAGATCGAAGCACGTCACAAAGA
CATTGTGCGTCTGGAGAGCAGCATAAAGGAGCTGCACGAC
ATGTTTGTGGACATTGCCATGCTAGTGGAGAGCCAGGGTG
GCATGATTGAAAGGATCGAGAACAACATGGACCAGTCAGT
GGGTTTCGTGGAGCGAGCCGTTGCTGACACCAAGAAAGCA
GCTAAATTTCAGCAGGAGGCTCGGCGTAAGAAAATGATGA
TCATGCTTTGCTGTGCGATTCTGGGGATTGTTGTGTTTTC
TTACCTTTACAGCTTCTTTTCATAATGGCTGAAGTGACCA
CAAGGACTCCTGCCCGTCCTCTCACATCCGTGTTTTGAAG
AGATGCGTTTACTGTGTAGTGTGCTTCAACCAAACGAACC
CTCACACCCTATCGAGTGACTGAAACCAGCGCCCTCTGCT
GTTCAACAACTTCATTAAACAAGGACAATTCCTTTCAAAA
GGAGCCCGGAGAGAGACAGACATGTCAATTTTTTTCGATG
TTTGTTCTAGTTAATTTTGGTAGTTAGTAGATGTAATTTC
GTCTCATAGTCTAATATGTTTGGTTGTATGTTTTAATGTT
GAAACGAGTGTTTTTAACAGTAGTATATACACTTAGCCTA
TTTTGAATACGTCAATATGGTATGGTTGTCTTTAATGTGT
TATGTTATCTAATAAAACGAGACCACAAGAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations