header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-1451
Transcript Name: cu469503.1-201
Previous Names: itga6-001, ottdart00000045816

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045816 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045816|OTTDARG00000032744|ZDB-GENE-050309-23 itga6a|OTTDARP00000036153 itga6-001 LG_ CU469503.13 Danio rerio protein_coding KNOWN, 1274 bp
TTCTGTCCTCTCACGGTGCTGCGGGAACTACATCAAAAAA
ACAAGGGCTATATTTTTCATACAACAGCATTCATTTCAGG
CAATGGAGCTCTTTGAGAAAGCGCTCTCTCTGAACCTGTG
CGTTTTTTCCTGGCTCGTCTGGACTTCAGCAAGTGCGTTT
AACCTGGACACGCAAAACGTCCTGAGGAAGAGCGGTCAGC
CCGGCAGCCTTTTCGGGTTCTCCATCGCCCTGCACCGCCA
GCTCCAGCCTCACGACAAAACAATATTGTTGATTGGTGCT
CCCAAAGCCAGGGCTTTATCCAATCAGGGAGCAAACGTGA
CGGGTGGGCTGTACAGCTGTGACATCACCACCCATCCTAA
CGACTGTAGCCGAGTGGACTTCGACAACGATGTTGATGTT
CGGGTGGAGAATAAGGAGAACCAGTGGATGGGTGTAACTG
TTCAGAGTCAAGGACCCGGAGGCAAGATTGTGACATGTGC
CCATCGCTACCAGCGGCTGCTGTTTCCGAACACCCCTCAA
GAGGCACGCGACATCACGGGGCGCTGTTATATGCTTAGTC
AGGACCTGAGCATTGACAACCAGTCGGATGAGGATGGAGG
GAACTGGAAGTTTTGTGACGGCCGCACCAGAGGTCATGAG
CGTTTCGGGGCCTGTCAGCAGGGCTTGGCGGCCACTTTCA
CCAAAGACTACCATTACGTTATCTTTGGAGCACCAGGGGC
GTACAACTGGAAAGGTATAGTGCGTATAGAGCAGAAGAAC
AACACTCTGCTGGAAATGGGCTTGTTTGATGACGGCCCTT
ACGAGGTCGGGGATGAAAACCGTCTGGATCCAAATCTAGT
GCCAGTACCTGCCAACAGCTACTTAGGATTTTCCCTGGAT
TCCGGCCACAGCATCACAGAGAAAGGCAAACTCATCATAG
TGTCAGGAGCGCCGAGAGCCAATCACAGCGGCGCAGTGGT
GTTTCTGCGCAAGGAAGGCGAGCTGTCCTCCATGCTCACA
CCTGAGCACATTCTGGAAGGACCAGGACTGGCGTCTTCAT
TTGGATATGATGTAGCTGTGGTGGACCTCAATGGAGACGG
TTGGCAGGATGTTGTGGTCGGTGCGCCTCAGTTCTTCCAG
AGGGATGAGGAAGTTGGTGGAGCTGTGTATGTTTACATCA
ACAAAGCCGGACGGTGGCGGGACGTCACTCCTGTTCGCCT
TAATGGAACCAAAGACTCCATGTTCGGTCTGTCTGTGGAG
AACATTGGAGACGTTAATCTGGATTCATTTGAAG

itga6a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cu469503.1-201 1274
itga6a-201 (1) 3231
itga6a-202 (1) 4057
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cu469503.1-201 Contained in:
OTHER cu469503.1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045816 (1)
  • Ensembl_Trans:ENSDART00000160977 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090730 (1) 1575bp
    CITATIONS (2)