header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14535
Transcript Name: itga6a-202
Previous Names: itga6-001, itga6a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033585 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033585|OTTDARG00000025531|ZDB-GENE-050309-23 itga6a|OTTDARP00000027181 DKEY-32O22.1-001 LG_none CU469503.13,BX248116.9 Danio rerio protein_coding NOVEL, 4057 bp
TTCTGTCCTCTCACGGTGCTGCGGGAACTACATCAAAAAA
ACAAGGGCTATATTTTTCATACAACAGCATTCATTTCAGG
CAATGGAGCTCTTTGAGAAAGCGCTCTCTCTGAACCTGTG
CGTTTTTTCCTGGCTCGTCTGGACTTCAGCAAGTGCGTTT
AACCTGGACACGCAAAACGTCCTGAGGAAGAGCGGTCAGC
CCGGCAGCCTTTTCGGGTTCTCCATCGCCCTGCACCGCCA
GCTCCAGCCTCACGACAAAACAATATTGTTGATTGGTGCT
CCCAAAGCCAGGGCTTTATCCAATCAGGGAGCAAACGTGA
CGGGTGGGCTGTACAGCTGTGACATCACCACCCATCCTAA
CGACTGTAGCCGAGTGGACTTCGACAACGATGTTGATGTT
CGGGTGGAGAATAAGGAGAACCAGTGGATGGGTGTAACTG
TTCAGAGTCAAGGACCCGGAGGCAAGATTGTGACATGTGC
CCATCGCTACCAGCGGCTGCTGTTTCCGAACACCCCTCAA
GAGGCACGCGACATCACGGGGCGCTGTTATATGCTTAGTC
AGGACCTGAGCATTGACAACCAGTCGGATGAGGATGGAGG
GAACTGGAAGTTTTGTGACGGCCGCACCAGAGGTCATGAG
CGTTTCGGGGCCTGTCAGCAGGGCTTGGCGGCCACTTTCA
CCAAAGACTACCATTACGTTATCTTTGGAGCACCAGGGGC
GTACAACTGGAAAGGTATAGTGCGTATAGAGCAGAAGAAC
AACACTCTGCTGGAAATGGGCTTGTTTGATGACGGCCCTT
ACGAGGTCGGGGATGAAAACCGTCTGGATCCAAATCTAGT
GCCAGTACCTGCCAACAGCTACTTAGGATTTTCCCTGGAT
TCCGGCCACAGCATCACAGAGAAAGGCAAACTCATCATAG
TGTCAGGAGCGCCGAGAGCCAATCACAGCGGCGCAGTGGT
GTTTCTGCGCAAGGAAGGCGAGCTGTCCTCCATGCTCACA
CCTGAGCACATTCTGGAAGGACCAGGACTGGCGTCTTCAT
TTGGATATGATGTAGCTGTGGTGGACCTCAATGGAGACGG
TTGGCAGGATGTTGTGGTCGGTGCGCCTCAGTTCTTCCAG
AGGGATGAGGAAGTTGGTGGAGCTGTGTATGTTTACATCA
ACAAAGCCGGACGGTGGCGGGACGTCACTCCTGTTCGCCT
TAATGGAACCAAAGACTCCATGTTCGGTCTGTCTGTGGAG
AACATTGGAGACGTTAATCTGGATTCATTTGAAGATATTG
CAGTAGGCGCTCCATATGCAGACTCAGGATTTGGCAGCGT
GTACATCTACCACGGATCTGCTGACGGCATCAGTACCAAA
CCGGCTCAGATACTGGAAGGCAAACAACACAACACTAAGA
TGTTTGGATATTCCCTTGCTGGAAATATGGACTTGGATCA
CAACTCGTACCCTGATCTGGCCGTGGGGTCACTTTCTGAC
ACAGTTTTCATATACAGGTCCAAAAATGTCATCAGCATCA
AGAAAGACATCAAGGTGACACCGAAGGAAATTGACTTGAC
GAAGAAAACATGTGGCAACAGTATTTGCTTGACAGTGGAA
GCGTGTTTCTCCTATAGAGCAAACCCCACAACCTACAACC
CCAAGATCACCATTTCCTGCACATTTGAGGCCGAGTGGTA
TCGCAGGAAGCTCGGTCTGCCGTCTAGAGTTGTGTTTCTG
GACAAAACCGAGATAGATCAGGACTATCAGTCAACTGGCA
CTCTGGAGCTGCGAGGACAGAACAAGAAAGCTTGTTATAA
AACCAAACTCCGATTACAAGACGGCATCAGGGACAAACTC
AGAGCGATTCCCATCGAGGTGTCTGTGGCCATTCAGAGCG
CTAAACGAGGCAAACGCCAGAGCTCTCTGCCTCAGCTAGT
GCCAATACTGGACTCCACAGTGCCCAACAAGACCCTCACT
GAGGTGAACTTCCTGAAGGAGGGATGTGGGACGGACAACA
TCTGCCAAAGCAACTTAAATCTGCAGTACAGGTTCTGCTA
CAGGGAGTCCAAGCAGGACATCTTTCCTCCTCTGCCTCTG
GAGAACGGTGTGCCGGTAATTTCTCTGAGTGATCAGAAGG
ACATTGCTCTGGAGGTCACGGTGAGGAACAGGAATGGAGA
TGACGCTCACGAAGCCAAACTCGTCAGCCATTTTGATGAT
TCTCTCTCGTACTCTGGATTCAGATCTCTGAGAACTAACG
ACAAACATGTGATCTGTGCAGCCAATCAGAATGGTTCCCT
GGCAGACTGTGAACTGGGAAACCCTTTTAAACGGGATTCA
GAGGTAACATTCTACATCATACTGAGCACAGGCAAGATCT
CACTCGAGACCAAAGAAGTCGAGATTGATCTTCAGCTGGA
AACAACGAGTTCGCAGGAGGGTCTGAGCAAAGTGAAGGCC
AAAGCCAAAGTGGTGATTGAACTGCTTCTGTCTGTACAAG
GGGTTGCCAAGCCCTCTCAGGTCTATTTTGGAGGTGAAGT
CAAAGGCATGAGCGCTATGAAGAAGGAGGAGGAAGTCGGC
AGCTTGATTGAATATGAATTCAGAGTGATTAATTTAGGAA
AGCCTCTGAAGTCTTTTGGAACCGCTTCGCTAAACATCCA
GTGGCCCAAAGAAAGTTCTGTGGGGAAATGGCTGCTGTAT
CTGATGAAGATCAACACCAGAGACCTGCAGTTGGTGACCT
GTTCACCCGAGAGAGAGATTAACCCTCTAAAGCTTAGAGA
GGATTCGTCAATCAGGAAAAAGCGGGAGCTGGAGGAGAGA
AGACCGTCTGAGGGGAATAAAATATCCCTTTTCACTGACA
AACGCAAACATAAGATCCTGTCTTGCAGTGGGGATGCCAG
ATGTGTGGAGATTAAGTGCCCTCTACAGGGCCTGGACAGT
ACTGCGGTCATCGTCTTGAAATCCCGCCTGTGGAACTCCA
CTTTCCTTGAGGATTTTGCATCCTACAATTACCTTGATAT
CATAGTGAAAGCCTCCATAAGTCTTGATGTTTCTGCCAAG
AATATCGTCCTGAAAAATCCTGAAACTCAGGTGAGGTTGA
CGGTGTTCCCGGAGACGACAGCGACTCCGTTTGGAGGAGT
GCCGTGGTGGATCATTCTAGTGGCTGTGTTAGCTGGAATC
CTAATGCTGGCTCTCTTAGTTCTGCTACTCTGGAAGTGTG
GGTTTTTCAAACGCTCCAAATACGAGGACAGCGTTCCCAA
ATATCACGCGGTGAGGATTCGTAAGGAGACGCGCCTCTTG
AAGGACGGGAAGGTCATGTTAGATCCCTTTGAGAAGAAGC
AGTGGATGACCACGTGGGATGAGAACGAGAGCTACTCATG
AGACTGTCCAATGCTATCCCGTGCCAATTCGTAACTTTGT
GATTTAGTGGCTAATTCGTAGGAATTCGTACGATCATATT
CGTACATTTTAGTATGATTTACTCAGTGATGGTTGGGTTC
AGGGGCGGGATTTGGTGCCACGCCTCCTTTTAAAAATCGT
ACATTATTGTAAGACTGAAATTGGACGATTTCATATGAAT
TAGCCACTAAAGTGAAATAACGTAAAATACTTGCGTTTCC
TCGTTAGATCAGGCTGGACTGTTGGCGTCTGCTGCAGACA
ATTTGGACTTGTGTAGTTTTGAACGGAGGAAGTTCAACCC
GCTGTTGAACAAGTCAAATGTGTTACTCAAGATGCCTTTA
CACGTCCTTGTGTTTCTGGATGGCTAAAGACTGACTGGTG
ACCTCTGGATATTTTACGTTTCGCACCCCTTCAAAAGTGT
TTGTATATTTTTGGAGGACGCATGAGATTTGCCAGGACTA
TATTGTCTTGATTGTAAATATTTCACAGTGCAGTTTATTT
ATTTGTATTTTTTCTTGTAATTTTATACTAAGACGTCTAC
TGTGCATGAACTGCCCAAAGATTATTTTTCATGTCTTTTT
TTTAAACTGTAAAATCAGATTTCATGTTTTGAGGTCAGCT
GAAACGCTGGAGGGAAAGAAGACAATAAACCAGTCAATGA
ATTACTACTGAAAAAAA

itga6a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cu469503.1-201 (1) 1274
itga6a-201 (1) 3231
itga6a-202 4057
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itga6a-202 Contained in:
OTHER itga6a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000033585 (1)
  • Ensembl_Trans:ENSDART00000114168 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090730 (1) 1575bp
    GenBank:CN510319 (1) 931bp
    GenBank:CT679317 (1) 835bp
    GenBank:CT588540 (1) 793bp
    GenBank:CK696083 (1) 756bp
    GenBank:CT588541 (1) 750bp
    GenBank:CK687883 (1) 620bp
    GenBank:EB929770 (1) 523bp
    GenBank:CK705515 (1) 521bp
    GenBank:EB777067 (1) 480bp
    GenBank:CB356123 (1) 447bp
    GenBank:AI558809 (1) 270bp
    CITATIONS (2)