Transcript

ottdart00000001810

ID
ZDB-TSCRIPT-141209-1217
Name
ottdart00000001810
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001810 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001810|OTTDARG00000001696|ZDB-GENE-990415-101 hoxb1a|OTTDARP00000001597 hoxb1a-001 LG_ AL645782.2 Danio rerio protein_coding KNOWN, 1860 bp
GCATGACATACTATTGCGAGCTTACAGGACAGGAGGCTTT
CTCGATTTCTCAGGTTGTCCCTCCGCCATTAATTGCGTAT
GGACAGTTCCAGAATGAACTCTTTCTTGGAGTACACAATT
TGTAACCGTGGGACGAACGCCTACTCGCCCAAGGCTGGAT
ACCACCACTTGGACCAGGCGTTCCCGGGCCCTTTCCACAC
TGGACACGCTAGTGACAGCTATAACGCTGATGGACGACTT
TACGTAGGGGGGAGCAATCAGCCACCAACAGCAGCAGCAC
AACATCAGCACCAGAACGGCATCTACGCGCATCACCAGCA
CCAAAATCAAACTGGCATGGGCCTTACCTATGGTGGAACT
GGGACAACAAGTTATGGGACACAGGCCTGCGCCAACTCGG
ACTATGCTCAACACCAGTATTTTATCAACCCTGAGCAGGA
TGGGATGTATTATCACTCATCAGGTTTTTCAACATCAAAT
GCCAGTCCACACTATGGCTCTATGGCCGGTGCGTACTGCG
GGGCACAGGGAGCCGTTCCAGCCGCACCTTATCAGCATCA
TGGATGCGAAGGCCAGGATCACCAGCGAGCATATTCACAA
GGCACCTACGCTGACTTATCGGCCTCTCAAGGAACGGAGA
AGGACACGGATCAGCCGCCACCTGGGAAGACATTCGATTG
GATGAAAGTCAAAAGGAATCCCCCCAAAACAGGTAAAGTG
GCTGAGTACGGACTAGGGCCGCAAAACACTATTCGGACAA
ATTTCACAACCAAACAACTGACAGAGCTCGAAAAAGAATT
TCACTTCAGCAAGTATCTGACGCGAGCGCGGCGTGTGGAG
ATTGCTGCCACACTTGAGCTTAACGAGACGCAGGTTAAGA
TTTGGTTTCAAAACCGCCGAATGAAACAGAAGAAGCGAGA
GAAGGAGGGACTCGCGCCTGCTTCCTCCACTTCGTCTAAA
GACCTCGAGGATCAATCTGATCACTCAACTTCAACATCTC
CAGAAGCCTCTCCAAGTCCGGATTCCTAACCGAGCACAAT
AACTTTGGGTGCACTGATCAAAAAATGTGAAATATATAGC
AAAGTCTATTAATTTAACCATTCCACTGTGGCCCAAAAGA
CTTGTTCTGTTGGGACAATTAATTGCAGGGAAAAACAACG
ACAGGCGAAAAAATGTGAAGAGCAAAAAGACTTTCTTTAA
CAATACAATGTAAAATTCCCAACACTTGCCTAAATTGTTT
GTGTGTTATACAGGGTATTTCTGCTGTGATTACAAATATA
ATGCACTTTCAGAATGTTTACGAGTCTCTGAGGGAACATA
AATGTCTTTACAGGGTTTTGTGTTGTCAAAATATTCATTG
ATGTTTTGTTGCGTTTTTTATGTATAGTTTTGATTTATGT
AAACATTTCATAGCCTTTATTTGAATTTTGTGGATTGTTA
GCTAAAACTTTTGGACTCCTTGCACTATGAGTTTACAGGG
TAGGCCTTTATTGAGCGCTAGCACAATTTCTTAAATACGT
GAACGATTCCTTCAGTGTACACGGTGGCGTTTAAATATTC
GTACATTTATAACGAGAAAGGAAAGAAATCAGGCGAGGTT
CAGAACAAAATTCTAGAATTTGTGAAATGCGCATATAGGG
AATGTTCAATTCTCCTGGGGAAAAGACAATGCAGGCTGTT
TAAAATACAATTTTCTTTGTTAAAACGTTTACAGAATTTG
ATATTTTAGCCTAGTACTTTATATGCGCAGACGAGCTGAG
TTTTATTAGTTATTGTCTGTATGAGTCCGTGATCGAAATG
CCTCAATCAGATGTTTGTCATTTCTTTATCTACCTCAAAT
AAAACGTTATTTTACTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations