Transcript

hoxb1a-201

ID
ZDB-TSCRIPT-090929-7277
Name
hoxb1a-201
Previous Names
  • hoxb1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024409 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024409|OTTDARG00000019759|ZDB-GENE-990415-101 hoxb1a|OTTDARP00000020154 hoxb1a-001 LG_ CR751227.13 Danio rerio protein_coding KNOWN, 1507 bp
TCTCGATTTCTCAGGTTGTCCCTCCGCCATTAATTGCGTA
TGGACAGTTCCAGAATGAACTCTTTCTTGGAGTACACAAT
TTGTAACCGTGGGACGAACGCCTACTCGCCCAAGGCTGGA
TACCACCACTTGGACCAGGCGTTCCCGGGCCCTTTCCACA
CTGGACACGCTAGTGACAGCTATAACGCTGATGGACGACT
TTACGTAGGGGGGAGCAATCAGCCACCAACAGCAGCAGCA
CAACATCAGCACCAGAACGGCATCTACGCGCATCACCAGC
ACCAAAATCAAACTGGCATGGGCCTTACCTATGGTGGAAC
TGGGACAACAAGTTATGGGACACAGGCCTGCGCCAACTCG
GACTATGCTCAACACCAGTATTTTATCAACCCTGAGCAGG
ATGGGATGTATTATCACTCATCAGGTTTTTCAACATCAAA
TGCCAGTCCACACTATGGCTCTATGGCCGGTGCGTACTGC
GGGGCACAGGGAGCCGTTCCAGCCGCACCTTATCAGCATC
ATGGATGCGAAGGCCAGGATCACCAGCGAGCATATTCACA
AGGCACCTACGCTGACTTATCGGCCTCTCAAGGAACGGAG
AAGGACACGGATCAGCCGCCACCTGGGAAGACATTCGATT
GGATGAAAGTCAAAAGGAATCCCCCCAAAACAGGTAAAGT
GGCTGAGTACGGACTAGGGCCGCAAAACACTATTCGGACA
AATTTCACAACCAAACAACTGACAGAGCTCGAAAAAGAAT
TTCACTTCAGCAAGTATCTGACGCGAGCGCGGCGTGTGGA
GATTGCTGCCACACTTGAGCTCAACGAGACGCAGGTTAAG
ATTTGGTTTCAAAACCGCCGAATGAAACAGAAGAAGCGAG
AGAAGGAGGGACTCGCGCCTGCTTCCTCCACTTCGTCTAA
AGACCTCGAGGATCAATCTGATCACTCAACTTCAACATCT
CCAGAAGCCTCTCCAAGTCCGGATTCCTAACCGAGCACAA
TAACTTTGGGTGCACTGATCAAATGTGAAATATATAGCAA
AGTCTATTAATTTAACCATTCCACTGTGGCCCAAAAGACT
TGTTCTGTTGGGACAATTAATTGCAGGGAAAAACAACGAC
AGGCGAAAAAATGTGAAGAGCAAAAAGACTTTCTTTAACA
ATACAATGTAAAATTCCCAACACTTGCCTAAATTGTTTGT
GTGTTATACAGGGTATTTCTGCTGTGATTACAAATATAAT
GCACTTTCAGAATGTTTACGAGTCTCTGAGGGAACATAAA
TGTCTTTACAGGGTTTTGTGTTGTCAAAATATTCATTGAT
GTTTTGTTGCGTTTTTTATGTATAGTTTTGATTTATGTAA
ACATTTCATAGCCTTTATTTGAATTTTGTGGATTGTTAGC
TAAAACTTTTGGACTCCTTGCACTATGAGTTTACAGGGTA
GGCCTTTATTGAGCGCTAGCACAATTTCTTAAATACGTGA
ACGATTCCTTCAGTGTACACGGTGGCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations