Transcript

slc25a18-202

ID
ZDB-TSCRIPT-131113-972
Name
slc25a18-202
Previous Names
  • slc25a18-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056481 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056481|OTTDARG00000039336|ZDB-GENE-041111-192 slc25a18|OTTDARP00000044289 slc25a18-001 LG_none CR376785.10,BX004976.7 Danio rerio protein_coding KNOWN, 3919 bp
GAAGAAAGTAAACGTTTATCTGTATAACGTCCTGAACTGT
ATCTCTTGATGTCACACTTTCAACCAACATAACAGCACAG
CAACGTTATGGATCTTCTAATCATGGAGTTTTTTAAGTAA
AGTGTTCACAGTGCTACAGATTCTACTAAGCAGCGCTGGA
CTGACGGTTGTGGATAACATACAGTGGAGAGATGCATTAC
AGATAAGGCATGGCACTGGATGAGGACAATCAGGATTGAA
AATAAACAGTTTGATTAGCGGAAAGCCGTGCATTCCCTGT
CCATGTCACTGGGAGTCGCCACGCGGGGGAGGGACTTCGC
CACAGATGGACAATGCGCGTGTTTGTGCAGCGGCCCCGGA
GTGTCGGATCTCCGGCGCTTGACTACGGCTTCTGTACACA
TTACCAGCGCATTGACGGCTCGATAAAACCGGTCACTGCA
CCGACAGAGGAAGGGTGTGAAGGTTGGCACTCTCAGTCGG
GACTCTACCCCGGTGGGCTGTGGAACGATTTGTGCTGACA
CCTTTTTTGTAGCAGAAAGAACAGGATTGGAGGAAATCAG
CTGAAGTTTGGCCAAAATGGCCGAAAAGAAACTGAGCCTC
CCTGCTAAGCTGATTAATGGTGGCGTGGCTGGACTGGTGG
GCGTGACCTGTGTGTTTCCCATTGATCTTGCTAAGACCCG
CCTACAAAACCAGCAGGGAGCTCGTGTTTATAGTGGAATG
CTGGACTGTTTGGCAAAGACGATCAAAATGGAGGGCTACT
TTGGCATGTATCGAGGTGCAGCTGTGAATCTCACACTTGT
AACTCCAGAGAAAGCCATCAAACTGGCTGCCAACGACGTC
TTCAGGCAGAAGCTCTCCAAAGATGGAAAATTACCTCTCT
GGGGGGAGATCCTTGCAGGCTGTGGGGCAGGAACCTGTCA
GGTGGTAGTCACCACCCCCATGGAAATGCTAAAAATACAA
CTGCAGGATGCTGGCAGGCTGGCTGCTCAGCGGACTGTCG
CTGCCTCTGCCCCTGCCTCCGGTCCGACCCCCTCCTTGGT
TGCCTCGCAGACCGCACATCCAGGCACCAGTGCACCACCT
CGCCGTTCAGCAACCCGGATCACAGTGGAGCTTCTAAAGA
CCCGAGGCCTCCGGGGGCTTTATAAGGGTGCAGGTGCTAC
GCTGATGAGGGACGTCCCGTTCTCCATGATCTACTTCCCT
CTGTTTGCCAACCTCAATGCTGTGGGCCGGGCAGAGGATT
GTAAAGCCCAGGAGCGGGCACCGTTCCTGCAGTCTTTTAT
GGCCGGCTGCATGGCAGGCTCAGTGGCGGCGGTCGCTGTC
ACTCCTCTGGACGTTATAAAGACTCGTCTACAAACATTAC
AGAAAGGAGAAGGAGAAGACTCATACAGAGGCATCATTGA
CTGCGCACAGCGCATTTTAAAGCGTGAAGGGCCCTCAGCG
TTCCTCAAGGGAGCGACGTGTCGAGCGCTGGTCATCGCTC
CACTTTTTGGCATTGCTCAAGGGGTCTATTTTCTGGGCGT
TGGCGAACACCTGATTGGGCTACTGGGATAGCGGCTGATG
ATGTCATACAGTACTGTTTCTACATGGGCCAAGACATGAA
GAAGGAAACATTGATTTATTGAAATGGTAAATACGAAGAG
AAATCCACACACCAACCAAAGGACTTTCAGCAACTTTGGG
AGAAACACAAGAAAGTTGTGAAACGCAAATCCATTTGTGT
AACATAAATACACACTAAACTTATCAAACTAAGTACCTAA
ACTGTAAACAGGGTTCTTTAGGTAAAACTGGAAGGTTTTT
TTGGCCAATGTTGAATTAATGTAGCTTTTGTGTCTAAAGC
CCATAGTTCCAATCGGTTTTAAACCAACATTATTAGTGAT
GATTCAGTCTTAAGTTGTGAACAGGGTCAATGTGTATTTA
GATGCGAAAAGAAGACTTGAAGTTTAATTGACTCTGAATC
TTTTAAATTTGGCAAGTAACAGATTTAAACAGTAAAAACA
AAAACAATTGCTGAAATGTTTTTTAAAACAGATTTTATTA
GCCTTAATCCAATACTATTCATAATGATTCATTTATTTGT
TGTGATCAAGAATCACATACATTTAGATTGCTGTAATTTA
ATTTCTAAATGTCTTTGAAAACACAATTAAGATCAATTTT
GAACCAACATGATTTCCAAAGGATTCTTTTATCCTTCATG
AAAAAGGTCTGTGTGGATTTGCACTGCAGAAAATGACTTG
AATCAAGGTTGAGATAAATCTGAATCTTTTACATGTAGGT
TTTTGCTCTCTTCCATTGAATCAGACCCTTAAACAGCAAT
TATATGCAGAAATGTCTTTTAAAGCCTTTAGGTTTAATCA
GTTTTAAACCAGCATGATTCAGGAGGATTGATTCATCGGT
AATAAAAAGGATCAATGTGTGTTTAGATTGCACAAAAAGA
CTTGAATCAAAGTTGAAGCGAAACTGAATCTTCTTACTTT
TGTCTCTCTCTCTCATTAAATCAGCAACAACTCTTTAACT
TAAAGTCAATCGACAAAATTAGTTTTGAACCAAAATTATT
CAAAATAATAATTTTACAGAGAACTGAATCAAAGCTGAAT
CTGAAAGTTCTAATTGTATCTTTTAGCATCTACAATTGAT
TCCAACACTAAAAAAACTAAACAAAATAAAATTCAATGTC
TTTAAATCTATAATTATATTTTGAAACCAACAAGATTCAT
CATTATTGATTTGTCTGTTATGAACGGTCAATGTGCATTT
AGATGATCTTGAATCAAAATGAATCTGAATCTACTAAATC
TCTGTTTTGCCATTAAATCAAACCCTTTAAAGGGCAACAG
CATATATACAGAGATATCTTTAAAGCCAATCGATACAATC
AGTTTTAAACCAGAATGATTCAAAATGATTCATTAATGCA
CAGAAAAGACTCAATTAGCACTATAGCACTGAGCAGTATA
GAGTCCCCTTCACTATACTGGGGTGTTAGGACCTACACAG
ACCGCAGGTAAAGCACCCCCTGTTGGCCTCACTAACTCCA
CTTCCGACAGCAATCTAGCTTTCCCAGTTGGTCTCCCAAT
TAGGCTATGATCGGGTGTAGCCCTGCTCAGCTTCAGTGGG
CCACCATTTTAGCATTTATAGTTGATTTCAAAACAACAAC
AAACAAATAAAGTCTTTAAACCTACAGCATAGTTCTGCTC
AATTTAAAACCAACATGATTTATGATTATTAAATATTGTC
TGTTATGAACAGGGTCAATGCGCACTTAGATGAGCTTGAA
TCGAAACGAATCTGAATCTACTAAATCTGTGTTTTGCCAT
TGAATCAGACCCTTTAAAGAGCAAAAAAAAAAAAAAAAAA
ACATATTGACATGTAGCCAATCGATACAATCAGTTTTACC
AAAATGATTCACTTATTGATGAACAGGGTCAATGTGCACA
GGGTCAATGTGCATTTGGATGGCAAAAAAAATCTAAGTTT
AGAAGGATCTGAATCTTCTAAATGTATGTTTTGTCACTCT
ACTGCATTTAATCTGCAAAAAATAAAATAAAAAGCTGAAA
TGTCTTTCAATCAATAGATACAATCGATTTTATACCAACA
TAACAAATATATCCATAGAGAGCAACAATGACAAATATTT
TAGATTGCAGAAAGAAGCTCTGAATCTGAAAATCTGAATC
TTCTAAATGATTTGACTCACTTTTTCAGTGACCATTTACT
CAACGTAACTGTGGTCTGTCAGTAAATCTGTTTGTGGAGA
CACTGCTGGGCTTTGTCTGGAGCCTGGTTGTTATGTAGAC
TGTATAACGTCAAATTAATTTTTTTAATGCTTCTTTAAAT
GATTTTGTTGAGTGTGAAATATATTAAAATGCAACAAAGC
CTTATCCTTGACACTCGAGTTTTAATCTAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations