header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-972
Transcript Name: slc25a18-202
Previous Name: slc25a18-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056481 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056481|OTTDARG00000039336|ZDB-GENE-041111-192 slc25a18|OTTDARP00000044289 slc25a18-001 LG_none CR376785.10,BX004976.7 Danio rerio protein_coding KNOWN, 3919 bp
GAAGAAAGTAAACGTTTATCTGTATAACGTCCTGAACTGT
ATCTCTTGATGTCACACTTTCAACCAACATAACAGCACAG
CAACGTTATGGATCTTCTAATCATGGAGTTTTTTAAGTAA
AGTGTTCACAGTGCTACAGATTCTACTAAGCAGCGCTGGA
CTGACGGTTGTGGATAACATACAGTGGAGAGATGCATTAC
AGATAAGGCATGGCACTGGATGAGGACAATCAGGATTGAA
AATAAACAGTTTGATTAGCGGAAAGCCGTGCATTCCCTGT
CCATGTCACTGGGAGTCGCCACGCGGGGGAGGGACTTCGC
CACAGATGGACAATGCGCGTGTTTGTGCAGCGGCCCCGGA
GTGTCGGATCTCCGGCGCTTGACTACGGCTTCTGTACACA
TTACCAGCGCATTGACGGCTCGATAAAACCGGTCACTGCA
CCGACAGAGGAAGGGTGTGAAGGTTGGCACTCTCAGTCGG
GACTCTACCCCGGTGGGCTGTGGAACGATTTGTGCTGACA
CCTTTTTTGTAGCAGAAAGAACAGGATTGGAGGAAATCAG
CTGAAGTTTGGCCAAAATGGCCGAAAAGAAACTGAGCCTC
CCTGCTAAGCTGATTAATGGTGGCGTGGCTGGACTGGTGG
GCGTGACCTGTGTGTTTCCCATTGATCTTGCTAAGACCCG
CCTACAAAACCAGCAGGGAGCTCGTGTTTATAGTGGAATG
CTGGACTGTTTGGCAAAGACGATCAAAATGGAGGGCTACT
TTGGCATGTATCGAGGTGCAGCTGTGAATCTCACACTTGT
AACTCCAGAGAAAGCCATCAAACTGGCTGCCAACGACGTC
TTCAGGCAGAAGCTCTCCAAAGATGGAAAATTACCTCTCT
GGGGGGAGATCCTTGCAGGCTGTGGGGCAGGAACCTGTCA
GGTGGTAGTCACCACCCCCATGGAAATGCTAAAAATACAA
CTGCAGGATGCTGGCAGGCTGGCTGCTCAGCGGACTGTCG
CTGCCTCTGCCCCTGCCTCCGGTCCGACCCCCTCCTTGGT
TGCCTCGCAGACCGCACATCCAGGCACCAGTGCACCACCT
CGCCGTTCAGCAACCCGGATCACAGTGGAGCTTCTAAAGA
CCCGAGGCCTCCGGGGGCTTTATAAGGGTGCAGGTGCTAC
GCTGATGAGGGACGTCCCGTTCTCCATGATCTACTTCCCT
CTGTTTGCCAACCTCAATGCTGTGGGCCGGGCAGAGGATT
GTAAAGCCCAGGAGCGGGCACCGTTCCTGCAGTCTTTTAT
GGCCGGCTGCATGGCAGGCTCAGTGGCGGCGGTCGCTGTC
ACTCCTCTGGACGTTATAAAGACTCGTCTACAAACATTAC
AGAAAGGAGAAGGAGAAGACTCATACAGAGGCATCATTGA
CTGCGCACAGCGCATTTTAAAGCGTGAAGGGCCCTCAGCG
TTCCTCAAGGGAGCGACGTGTCGAGCGCTGGTCATCGCTC
CACTTTTTGGCATTGCTCAAGGGGTCTATTTTCTGGGCGT
TGGCGAACACCTGATTGGGCTACTGGGATAGCGGCTGATG
ATGTCATACAGTACTGTTTCTACATGGGCCAAGACATGAA
GAAGGAAACATTGATTTATTGAAATGGTAAATACGAAGAG
AAATCCACACACCAACCAAAGGACTTTCAGCAACTTTGGG
AGAAACACAAGAAAGTTGTGAAACGCAAATCCATTTGTGT
AACATAAATACACACTAAACTTATCAAACTAAGTACCTAA
ACTGTAAACAGGGTTCTTTAGGTAAAACTGGAAGGTTTTT
TTGGCCAATGTTGAATTAATGTAGCTTTTGTGTCTAAAGC
CCATAGTTCCAATCGGTTTTAAACCAACATTATTAGTGAT
GATTCAGTCTTAAGTTGTGAACAGGGTCAATGTGTATTTA
GATGCGAAAAGAAGACTTGAAGTTTAATTGACTCTGAATC
TTTTAAATTTGGCAAGTAACAGATTTAAACAGTAAAAACA
AAAACAATTGCTGAAATGTTTTTTAAAACAGATTTTATTA
GCCTTAATCCAATACTATTCATAATGATTCATTTATTTGT
TGTGATCAAGAATCACATACATTTAGATTGCTGTAATTTA
ATTTCTAAATGTCTTTGAAAACACAATTAAGATCAATTTT
GAACCAACATGATTTCCAAAGGATTCTTTTATCCTTCATG
AAAAAGGTCTGTGTGGATTTGCACTGCAGAAAATGACTTG
AATCAAGGTTGAGATAAATCTGAATCTTTTACATGTAGGT
TTTTGCTCTCTTCCATTGAATCAGACCCTTAAACAGCAAT
TATATGCAGAAATGTCTTTTAAAGCCTTTAGGTTTAATCA
GTTTTAAACCAGCATGATTCAGGAGGATTGATTCATCGGT
AATAAAAAGGATCAATGTGTGTTTAGATTGCACAAAAAGA
CTTGAATCAAAGTTGAAGCGAAACTGAATCTTCTTACTTT
TGTCTCTCTCTCTCATTAAATCAGCAACAACTCTTTAACT
TAAAGTCAATCGACAAAATTAGTTTTGAACCAAAATTATT
CAAAATAATAATTTTACAGAGAACTGAATCAAAGCTGAAT
CTGAAAGTTCTAATTGTATCTTTTAGCATCTACAATTGAT
TCCAACACTAAAAAAACTAAACAAAATAAAATTCAATGTC
TTTAAATCTATAATTATATTTTGAAACCAACAAGATTCAT
CATTATTGATTTGTCTGTTATGAACGGTCAATGTGCATTT
AGATGATCTTGAATCAAAATGAATCTGAATCTACTAAATC
TCTGTTTTGCCATTAAATCAAACCCTTTAAAGGGCAACAG
CATATATACAGAGATATCTTTAAAGCCAATCGATACAATC
AGTTTTAAACCAGAATGATTCAAAATGATTCATTAATGCA
CAGAAAAGACTCAATTAGCACTATAGCACTGAGCAGTATA
GAGTCCCCTTCACTATACTGGGGTGTTAGGACCTACACAG
ACCGCAGGTAAAGCACCCCCTGTTGGCCTCACTAACTCCA
CTTCCGACAGCAATCTAGCTTTCCCAGTTGGTCTCCCAAT
TAGGCTATGATCGGGTGTAGCCCTGCTCAGCTTCAGTGGG
CCACCATTTTAGCATTTATAGTTGATTTCAAAACAACAAC
AAACAAATAAAGTCTTTAAACCTACAGCATAGTTCTGCTC
AATTTAAAACCAACATGATTTATGATTATTAAATATTGTC
TGTTATGAACAGGGTCAATGCGCACTTAGATGAGCTTGAA
TCGAAACGAATCTGAATCTACTAAATCTGTGTTTTGCCAT
TGAATCAGACCCTTTAAAGAGCAAAAAAAAAAAAAAAAAA
ACATATTGACATGTAGCCAATCGATACAATCAGTTTTACC
AAAATGATTCACTTATTGATGAACAGGGTCAATGTGCACA
GGGTCAATGTGCATTTGGATGGCAAAAAAAATCTAAGTTT
AGAAGGATCTGAATCTTCTAAATGTATGTTTTGTCACTCT
ACTGCATTTAATCTGCAAAAAATAAAATAAAAAGCTGAAA
TGTCTTTCAATCAATAGATACAATCGATTTTATACCAACA
TAACAAATATATCCATAGAGAGCAACAATGACAAATATTT
TAGATTGCAGAAAGAAGCTCTGAATCTGAAAATCTGAATC
TTCTAAATGATTTGACTCACTTTTTCAGTGACCATTTACT
CAACGTAACTGTGGTCTGTCAGTAAATCTGTTTGTGGAGA
CACTGCTGGGCTTTGTCTGGAGCCTGGTTGTTATGTAGAC
TGTATAACGTCAAATTAATTTTTTTAATGCTTCTTTAAAT
GATTTTGTTGAGTGTGAAATATATTAAAATGCAACAAAGC
CTTATCCTTGACACTCGAGTTTTAATCTAAAAAAAAAAA

slc25a18 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slc25a18-202 3919
slc25a18-203 (1)    Ensembl 882
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc25a18-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056481 (1),  Ensembl_Trans:ENSDART00000155764 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT736763 (1) 813 bp
GenBank:DN899457 (1) 772 bp
GenBank:CT672569 (1) 753 bp
GenBank:DN898806 (1) 667 bp
GenBank:BI706817 (1) 501 bp
GenBank:AI585234 (1) 480 bp
GenBank:CD594100 (1) 344 bp
CITATIONS (2)