ZFIN ID: ZDB-TSCRIPT-131113-2565
Transcript Name: slc25a18-203
Previous Name: slc25a18-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056482 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056482|OTTDARG00000039336|ZDB-GENE-041111-192 slc25a18|OTTDARP00000044290 slc25a18-002 LG_none CR376785.10,BX004976.7 Danio rerio protein_coding KNOWN, 882 bp
ATCTGCCGGGCTTGTGTGTTGTGGAAAGTCTTTTAGGGAT
GGGGAGGGAGAGTGGGGCCAGATCTCTCACTTGTCTGTGT
TTTGGCAGTGGAGGGGTTTTGAATAGAGCAGAGTTGAAAG
GAAGCAGTGCTGAAGGGAAAGGCATGCTCAGAATGCCACT
GCTGGGCTCCAGAAAAGACAGAGCAAAGAGGCAGAAAGAG
GGGATGTGAGTGTGCCGGAGGGAAAGACACTGAGAATGCT
ACCTCAAATTAGGGGAGAGTTAGTTGAAATGGAGAAGCTT
ACGTTTAAGACATGTTAAAGGAAGGGTGTGAAGGTTGGCA
CTCTCAGTCGGGACTCTACCCCGGTGGGCTGTGGAACGAT
TTGTGCTGACACCTTTTTTGTAGCAGAAAGAACAGGATTG
GAGGAAATCAGCTGAAGTTTGGCCAAAATGGCCGAAAAGA
AACTGAGCCTCCCTGCTAAGCTGATTAATGGTGGCGTGGC
TGGACTGGTGGGCGTGACCTGTGTGTTTCCCATTGATCTT
GCTAAGACCCGCCTACAAAACCAGCAGGGAGCTCGTGTTT
ATAGTGGAATGCTGGACTGTTTGGCAAAGACGATCAAAAT
GGAGGGCTACTTTGGCATGTATCGAGGTGCAGCTGTGAAT
CTCACACTTGTAACTCCAGAGAAAGCCATCAAACTGGCTG
CCAACGACGTCTTCAGGCAGAAGCTCTCCAAAGATGGAAA
ATTACCTCTCTGGGGGGAGATCCTTGCAGGCTGTGGGGCA
GGAACCTGTCAGGTGGTAGTCACCACCCCCATGGAAATGC
TAAAAATACAACTGCAGGATGCTGGCAGGCTGGCTGCTCA
GCGGACTGTCGCTGCCTCTGCCCCTGCCTCCGGTCCGACC
CC

slc25a18 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slc25a18-202 (1)    Ensembl 3919
slc25a18-203 882
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc25a18-203 Contained in:
[BAC] CH211-266K8 (1), CH211-276C7 (1)

Genome Resources: Vega_Trans:OTTDART00000056482 (1),  Ensembl_Trans:ENSDART00000156548 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH436983 (1) 900 bp
CITATIONS (2)