ZFIN ID: ZDB-TSCRIPT-131113-622
Transcript Name: si:dkey-195m11.8-203
Previous Names: dkey-195m11.8-001, si:dkey-195m11.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055081 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055081|OTTDARG00000038445|ZDB-GENE-030131-3092 si:dkey-195m11.8|OTTDARP00000043199 DKEY-195M11.8-001 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 3869 bp
AGGACAGAGGGAGGTTGTGCAGAGTTGCATAGAAGAAAAA
AAGAAGAGGCAAGAAACAAAAAAAAAGAGTGTGAAGGCAT
GGCAGCGTAAAGCCTGGAATTTACTTACAACTGCTACATT
GCAATGGAGATGCACAAAGCACTGGTTTCTGTGTTTATGA
ACAATGGTGGGAAGACTTTTGCACATCATTAGCTTTTACA
ATCAACTCACAAAAATAAGCTGATACAGAATTCTGGTTAA
AACAGCATGGTGTGGTAATGATGCAGTGGTCATCCGAGTG
GGCGGAGCAACACTATGATGTCTCCTCCACCACATCTCCA
CCAGTTCATCCTAAGCCCCTCCCATTTCCTCAGCCCAGTC
GTCCTGCATTCTCTGGCTACAGTGATGACATCAGTGCGCT
CAGTGCCTCCAGCTTACTAAAGCGCTACGCCGAGAGGTAC
TCCTTCAACTCTGCCCTACCAGAACATGGGAGTTTCCTGA
GAAGTGAGCAGCCCCAGGAGCCATGGCCAGGGGGGTACAG
CACAGAGGGGCCTGCTGGTTTAGACCCACTGAAGGCCAGC
GGAAGTGATCTCTCCGAGCCACAATACAGCAGTGCTCCCA
CTCAAGATTACCCTTCATCTTACAGCAGTCAGCATCTTCT
GCCCAAACCATCCTATCTTCCATCACCAGCGTTTGCCTTG
CCATCTGCATACTTGCCCCCTGCACCAGGCTACGCTTATC
CCCAACAGTGTTACCCCCACAACACCCCATCTCTTCTGAC
CTCGGGTCTGCACACCCCTACACCTCTCCACGGGGCAGCT
GAACTCCCACGAAACCGGAAGATCGGCTTCGACCAGTCCA
AAACTGCCAGAGTGTCACCTTACACAATCAGGGATAAGAG
TGAACGGCAGAATGGTGACAGCGGTGGAAGTGTCAACGAA
AGCTGTGGGACGGACATCCAGAGCTATAGGCCAGAGAGAC
TTTCCACTCTGCCCGATCTCGAGGCAGATGCTGAGGGTAA
GAGCAGTCACCTGCGGCCTCTGGAGACACGCTCTTATGGA
GGTCCAGGACAATATACGTATCCCTGAGTCTACTTGATGT
AGCCAGTTGATGCTTTTTTTATACGTTTATAGCAATACTT
GAATGTATTAAACATCAGGACGAATGTTACTGTGGTACTG
TGGTAAAATTTAATTGTAAAATCAGAAACTCCATAACAGA
GCCATTTTTCATTCCCCAAAGAACCTGTCAGTGAACAGTA
TTCAGTTCTGTAAAGAACCATTTTTATGCAAGGAACAATG
GCAAAATCTAATGAACCAGTAGAAAGATACCATGGATGCT
CAAGCTAAATTTTAAATCGTCATTATTTAAGGCACAGATA
TACTTCAAACAAAATCAACAAACTAAAATGACGTAATTTC
AAACAAAATCCAGGCAAATCGAAGTTATTTGGAGTACATT
TTGGCAGTTTGAAGCAGCTGACCAAAGCAAACTTTTGGGG
GAGTTCGTTTTAGCTCCTTTTTAACTTGTGTTAAACACCT
TTGAGCTCCCATTGGTCAATGACGATAAGGCAATCAGTGG
CTGTAACTCCGCCTTCTTTGATCCAGACAGGAGAACAACA
TCCAATTGCTCTGACACCAGACAAGAAGCCCACCTTGTTG
CACCACATCTTTTTCATGAATTTGCGCACACCGGCGGCAA
ATAAAAAAAAAATAATAATAATAATAATTCCTTACGTTTA
TATAGCTCTTTTCTGGACACTCAAAGCGCTTTTAACGATG
GGGGAATCTCCTCATCCACCACCAGTGTGCAGCATCCACC
TGGATGACACGATGGCAGCCATATTGCCGCACACCACACA
CCAGCTGATTGGTGGAGAGGAGACAGAGTGATAAAGCCAA
TTATGATATAAGGATGGTTAGGAGGCCATGATAGACAGAG
ACCAGTGGGCAAATTCGACCAGGATGCTGGGGTTAAACAC
TACTCCTCTTTGATGGACATCCTGGAATTTTGAATGACCA
CAGAGAGTCAGGACTTAAGTTTGACGTCTCAGAAAAACAG
CGCTCATTGAGCAGTATAGAGTCCCCATCAGTATACTGGG
GCATTAGGACCCACATAGACCGAAGGTTGAGCACCCCCTG
TTGGCCTTTCTAACACTATTTCCGGCAGCAACCTAGCTTT
CCCATGTGGTCTCCCATCCAGGTACATACCCCTGCTTAGC
TTGAGTTAGTGGCCATATAGGAGTTGCAGATAGCTAGCTG
CCAGAAATCAGTGTAAAAATGTGATGCACTTCTTGTGTAG
ATGGCTGTTTGCTAGATGTTTATGAAACTGTTCTCTCTCA
GCCACCATTGTTGTATTTAGGGCTAAATGACACATTTACA
ACCCCACCCACTAGAGCTAGGGGTGTCAGAGGGTTTCAAA
CAGTACTTCGTCAATCAGTCATTAATGATACAGAATGATA
TAGAACATAGTTTGAAGTATATCAGGGTCTTCATTCACCT
TTCACATGTTTCAAACATGTTTGAGTTTCTTTCTTCATGT
GAACACAAAAGAAGATTGTGGTAGAAGAATGTGGTAAACT
CGCAGCCAAAAATGGTAGTCAGTGGATACCAGTTTACAAC
ATTCTTCAAAATTTATTCTTTTGCATTCGTGAGGGTGATT
AAATAATGATTCATTTTCCATTTTTTTGGGGAGCGAACTA
TCGCTTTATTAGAGGTTCTTCAGAAAACCATAAAACAACA
TTTTTAAAAGTTTATGAAACTTCAGATTGGGAAGATTTAC
TGATGTCTCTTTAATCAACATTATCATTATTCCTTACTGC
CACTTTAACGGGACCTGTGGCACAGATACTCTTTTGTATC
CTCTTTTTGTATTCTCTTCCTTTCCTCTTTTCCTCTTTCT
GTCGCTCTATAATTATGCTGTGCAGTGAAGCACGTTATGG
TGGCAAGCACTAAACCACCGCTTCAATCAATGAAATCCAA
GCCAAAGGAAGACTGAAAGAGAGGAACGGAAAAGAAATAG
AAGAAATAATGAACAAAAAAATGAAGCTGCGTTAAAGCAC
ACATTTGAAAGTTTCATGTCACACGTGTAATATATGGTTC
TCATTCTATTTGTATGTCAGTGGTGATAGTCATGGATGTT
CTCCAACACTGAAGTCCGTGAGCTAAAAACACTCATATTT
TAGGAATATTATGTAAAATTCCTCTATAAACTTTGAATGT
AAAGCCGATTTTCCTCAGGAATTGTGAATGAAGCCATACT
TTATGTTTATCTTATACAAATTTTAAGTTTTTAATGTCTA
GTTAGTGTAGTTTTTTTGTTGTTGTCATGTCTGTCATTAA
AATGAAATGTATTTGTAACTTTACTTACAGTATTTCAATG
ATTAAACAACGACTCGCCGTTTTTTTTACAAACTGCATAA
TCCTAGCTTTCCCAGGGCTGCTGCAAAAAAAGGCTAAAGG
GATTTTTCGCAGTCTTTTCCACTATTCACCTATTGTGAGG
TTTACTATGGGAACCCGCAGAGCAGTCCCAGCCCCCTGAG
TTGATCACTGGATGTGTTTTCCTCTGACCCTCTGACCCTT
CTCTGTTTTAAATGAGGCATGCAAAAGAATAGAGAGCTTT
TGTTATGGTGAGGCACGCTGGACATACACTGAAATGTACA
AACTGAACTGAAAATGACAGTTTAGTTAATATTTAATTTT
GATAAATGTGTCAAATGTAACACTCACAAACGCATTACAT
GGGACAAAATCATGTTACTTCATAAATATACAATACGTTC
TACCTCACGGTTACAATTCTGAATGTTCAAAGTATGCAAT
TGTGTATTACATGTTTAAATGTCTACCTCAAGAAAAAAAC
ACAAAATAAAATCTATCATACCAATACAA

si:dkey-195m11.8 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-195m11.8-003 (1) 500
mRNA si:dkey-195m11.8-201 (1) 525
si:dkey-195m11.8-203 3869
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-195m11.8-203 Contained in:
OTHER si:dkey-195m11.8-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055081 (1)
  • Ensembl_Trans:ENSDART00000157165 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT633894 (1) 883bp
    GenBank:EH587792 (1) 523bp
    CITATIONS (2)