header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-3806
Transcript Name: si:dkey-195m11.8-003
Previous Name: dkey-195m11.8-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055083 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055083|OTTDARG00000038445|ZDB-GENE-030131-3092 si:dkey-195m11.8|no_translation DKEY-195M11.8-003 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 500 bp
AGAAAAAAAGAAGAGGCAAGAAACAAAAAAAAAGAGTGTG
AAGGCATGGCAGCGTAAAGCCTGGAATTTACTTACAACTG
CTACATTGCAATGGAGATGCACAAAGCACTGGTTTCTGTG
TTTATGAACAATGGTGGGAAGACTTTTGCACATCATTAGC
TTTTACAATCAACTCACAAAAATAAGCTGATACAGAATTC
TGGTTAAAACAGCATGAGGATGTGCTTTGTAAATAGATCC
CAGGCTGAATTCTTAGCATTCCGTGTGCAGCCGTATTTAT
GGATGGGATCCTGTCTCTTCAGTGGAAAGTGTGTGAAATG
GAGGGAAGCAGCAAAAGATATAAAGATAACACAGAAACAG
CCATAGGCATTAACTATTCGGAATGAACAAGAGCATTTAT
GCGTAGCAAGGATTTGTTGGATTAGCCAAAAATCTTGACT
CCAGAACTGTGGTGAATATAGTAATGTTGATGTATATTTG
TTTAAAATGCTCTTAGTGTG

si:dkey-195m11.8 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-195m11.8-003 500
mRNA si:dkey-195m11.8-201 (1) 525
si:dkey-195m11.8-203 (1) 3869
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-195m11.8-003 Contained in:
OTHER si:dkey-195m11.8-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055083 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL726988 (1) 584bp
    CITATIONS (1)