ZFIN ID: ZDB-TSCRIPT-131113-2210
Transcript Name: si:dkey-195m11.8-201
Previous Names: dkey-195m11.8-002, si:dkey-195m11.8-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055082 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055082|OTTDARG00000038445|ZDB-GENE-030131-3092 si:dkey-195m11.8|OTTDARP00000043200 DKEY-195M11.8-002 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 525 bp
ATAGAAGAAAAAAAGAAGAGGCAAGAAACAAAAAAAAAGA
GTGTGAAGGCATGGCAGCGTAAAGCCTGGAATTTACTTAC
AACTGCTACATTGCAATGGAGATGCACAAAGCACTGGTGT
GGTAATGATGCAGTGGTCATCCGAGTGGGCGGAGCAACAC
TATGATGTCTCCTCCACCACATCTCCACCAGTTCATCCTA
AGCCCCTCCCATTTCCTCAGCCCAGTCGTCCTGCATTCTC
TGGCTACAGTGATGACATCAGTGCGCTCAGTGCCTCCAGC
TTACTAAAGCGCTACGCCGAGAGGTACTCCTTCAACTCTG
CCCTACCAGAACATGGGAGTTTCCTGAGAAGTGAGCAGCC
CCAGGAGCCATGGCCAGGGGGGTACAGCACAGAGGGGCCT
GCTGGTTTAGACCCACTGAAGGCCAGCGGAAGTGATCTCT
CCGAGCCACAATACAGCAGTGCTCCCACTCAAGATTACCC
TTCATCTTACAGCAGTCAGCATCTTCTGCCCAAACCATCC
TATCT

si:dkey-195m11.8 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-195m11.8-201 525
si:dkey-195m11.8-203 (1)    Ensembl 3869
ncRNA si:dkey-195m11.8-003 (1) 500
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-195m11.8-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000055082 (1),  Ensembl_Trans:ENSDART00000155079 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CB356078 (1) 528 nt
GenBank:AI958065 (1) 489 nt
CITATIONS (2)