ZFIN ID: ZDB-TSCRIPT-131113-4610
Transcript Name: hsp90aa1.1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059427 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059427|OTTDARG00000006778|ZDB-GENE-990415-94 hsp90aa1.1|no_translation hsp90aa1.1-002 LG_ CR381646.8 Danio rerio protein_coding KNOWN, 283 bp
CGGATTAATTGACGCATTCATTCCAAACCGCGACTGAAAC
AACGTGTTTACGTCAGACTGTTGCTACTTGTTTTCAAACG
AGGATGGATTCGAGTGACGCACCCAATCAGCTATCGGTAT
TCTGCTGTCAGAAAGTCACATGTCTTCGTCGACGGCTCCA
TGTGGCTCCGGAACCTTCTGTCTTTGATTGACAGGCCCAT
CTGCGACCGCTGTCCCAACATGGACATGCTGGAGCCCTGC
ACTTCAGCAGGCGTTTCGTCTGGAAGTTTCTGGATGGAGG
GTT

hsp90aa1.1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hsp90aa1.1-201 (1)    Ensembl 2543
ncRNA hsp90aa1.1-002 283
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hsp90aa1.1-002 Contained in:
[BAC] DKEY-241L7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000059427 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB911470 (1) 283 bp
CITATIONS (1)