header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-988
Transcript Name: hsp90aa1.1-201
Previous Names: hsp90a.1-001, hsp90aa1.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000007554 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000007554|OTTDARG00000006778|ZDB-GENE-990415-94 hsp90aa1.1|OTTDARP00000006700 hsp90aa1.1-001 LG_ CR381646.8 Danio rerio protein_coding KNOWN, 2543 bp
CTGGAAGTTTCTGGATGGAGGGTTCGAGAAGCTCTGGTCT
TAATATAAGGCGAGGACGCAGCAGATAACGGCAGACCCGC
GACGAGAAGACTGGAGTACAACACCTCCAAACACAAAACC
ACTGCAAAGACTTTCTGCACTCGAGACGACCACACAGCAA
GATGCCTGAGAAGTCGGCCCAGCCCGTGATGGAGGAGGAG
GTGGAGACGTTTGCGTTTCAGGCTGAGATCGCTCAGCTCA
TGTCTCTGATCATCAACACCTTCTACTCCAACAAGGAGAT
CTTCCTCCGAGAGCTCATCTCCAACTCCTCTGATGCATTG
GACAAGATCAGATATGAGAGCTTGACAGATCCGAGCAAAC
TGGATTCATGCAAGGACTTAAAGATCGAACTGATCCCAGA
CCAGAAAGAGCGCACGCTGACCATCATCGACACCGGCATC
GGCATGACCAAAGCCGACCTGATCAACAATCTGGGCACCA
TCGCTAAATCCGGCACAAAGGCCTTCATGGAGGCTCTGCA
GGCCGGAGCGGACATTTCTATGATCGGTCAGTTCGGTGTG
GGCTTTTATTCTGCGTATCTGGTGGCCGAGAAAGTGACGG
TCATCACCAAACACAACGATGATGAGCAGTACATTTGGGA
ATCTGCAGCTGGCGGATCGTTCACTGTCAAGCCAGACTTC
GGTGAATCAATTGGACGTGGTACCAAAGTCATTCTCCACC
TTAAAGAGGATCAGTCTGAATATGTGGAGGAAAAGCGCAT
TAAGGAAGTGGTGAAGAAGCACTCTCAGTTCATCGGTTAC
CCAATTACGCTTTACATTGAGAAACAGAGAGAAAAAGAGG
TGGATCTTGAGGAAGGCGAGAAACAGGAGGAGGAGGAGGT
TGCAGCAGGCGAAGACAAAGACAAACCCAAAATTGAAGAT
CTGGGAGCTGATGAAGATGAAGACTCTAAGGATGGCAAGA
ATAAGAGGAAGAAGAAGGTGAAGGAAAAGTACATTGATGC
CCAGGAGCTGAATAAGACCAAGCCGATCTGGACCCGTAAC
CCCGATGACATCACCAATGAGGAGTACGGCGAGTTTTACA
AGAGTTTAAGCAATGACTGGGAGGATCACTTGGCTGTCAA
GCATTTCTCAGTTGAGGGCCAACTGGAGTTTCGCGCTCTA
CTTTTTGTACCCAGAAGAGCCGCTTTTGACCTTTTTGAGA
ACAAGAAGAAGAGAAACAACATTAAGTTATACGTGCGCAG
GGTTTTCATCATGGACAATTGCGAGGAACTCATTCCAGAA
TATCTCAACTTTATTAAGGGTGTGGTGGACTCTGAGGATC
TGCCTCTGAACATCTCCAGAGAAATGCTTCAACAGAGCAA
AATCCTGAAGGTGATCCGCAAAAACCTGGTCAAGAAGTGT
CTCGATCTCTTCACCGAACTGGCAGAGGATAAAGACAACT
ATAAGAAATACTACGAGCAGTTCTCCAAAAACATCAAGCT
TGGCATCCACGAGGACTCTCAGAATCGCAAGAAACTTTCT
GATCTTTTGCGCTACTACACTTCAGCTTCAGGAGATGAGA
TGGTGTCACTTAAAGACTATGTGTCTCGCATGAAGGACAC
ACAGAAGCACATCTACTACATCACCGGTGAGACCAAAGAT
CAGGTGGCGAACTCAGCGTTTGTGGAGCGCCTCCGTAAAG
CTGGTCTGGAGGTGATCTACATGATCGAGCCCATCGATGA
ATACTGTGTTCAGCAGCTGAAGGAATATGATGGCAAGAAT
CTGGTGTCGGTCACTAAAGAAGGCCTGGAGCTGCCCGAGG
ATGAAGAGGAGAAGAAGAAGCAGGATGAGCTGAAGGCCAA
ATATGAGAACTTGTGCAAGATCATGAAGGATATCCTCGAC
AAAAAGATTGAGAAGGTCACCGTCTCCAACCGTCTGGTGT
CTTCGCCCTGCTGTATCGTCACCAGCACATACGGCTGGAC
GGCGAACATGGAGAGGATCATGAAGTCTCAGGCTCTGAGG
GATAACTCTACCATGGGCTACATGACCGCTAAAAAGCACC
TAGAAATAAACCCAGCACACCCCATCGTGGAGACCCTCAG
AGAGAAAGCGGAAGCCGACAAAAACGACAAGGCGGTGAAG
GATCTGGTGATCCTGCTGTTCGAGACGGCGCTCTTATCCT
CAGGCTTCACACTGGACGACCCACAGACTCATGCAAACCG
CATCTACAGGATGATCAAACTCGGACTTGGCATCGATGAC
GATGACTCTGTGGTCGAGGAAATCTCTCAACCCGCTGAAG
AAGATATGCCCGTTCTGGAGGGAGACGACGACACTTCGAG
AATGGAGGAAGTCGACTAAAGAGTTTTAGTGTACAAATAA
AATCCGTAATGTAATGTAATTTATTGTTTTTGTATAAAAC
AATCCAGACATATCACAGTGAATGTTAGCTACTTTAAAGT
CCTTGTAATTGCCTTGTGTGTCTGCTCTTGCATTTTATAA
TTCAAACTTTCTTTTTGTAAACCTAAGCTGAACGTTTTTA
ATAAATGACTCCTTATAAATAAA

hsp90aa1.1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hsp90aa1.1-201 2543
ncRNA hsp90aa1.1-002 (1) 283
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hsp90aa1.1-201 Contained in:
[BAC] DKEY-241L7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000007554 (1),  Ensembl_Trans:ENSDART00000004756 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC075757 (1) 2499 bp
GenBank:AF068773 (1) 2482 bp
GenBank:CN330614 (1) 942 bp
GenBank:CK015776 (1) 931 bp
GenBank:CN322028 (1) 900 bp
GenBank:CT616722 (1) 745 bp
GenBank:BI896410 (1) 737 bp
GenBank:BM317173 (1) 594 bp
GenBank:AI883691 (1) 582 bp
GenBank:AI416373 (1) 567 bp
GenBank:AI878261 (1) 565 bp
GenBank:CB351944 (1) 501 bp
GenBank:CB353463 (1) 478 bp
GenBank:AI959210 (1) 454 bp
CITATIONS (2)