Transcript

crebzf-201

ID
ZDB-TSCRIPT-131113-4608
Name
crebzf-201
Previous Names
  • crebzf-003
  • ch73-201p13.1-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059416 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059416|OTTDARG00000041182|ZDB-GENE-030131-8015 crebzf|OTTDARP00000046322 CH73-201P13.1-003 LG_ CU896603.6 Danio rerio protein_coding KNOWN, 877 bp
AGTGCAAGTGAAACAAACACGCACACCTCTCCAGAAAGCG
ACACCAACGATTGGGGCTTGGATGATCTGCTTGGCTCCGA
GTTCAACTGGGACCTGGACAAGGATATGCTTGAAGCTTTC
AGCAGCTTTGAATCGCAGACATCAGTCTACAATGAAACAA
TCCAAAGTGCAGAGCTTGATGTTTCCGCATCACGTATGGT
CCAGAGGTCAAAACTACTAGACGTCTCCGGCCGGATCATC
AACAAGAACGCCATAGCTGCAAGGATAAACCGATTAAAGA
AGAAAGAATACGTCAGTGGCTTGGAGCAGAGAGTTGGCTC
TTTGACTACAGAAAACCGCGTGCTCAAGCAGGAAAACGGA
AATCTCAACAAGAGAGTGGAAGAGTTGGAGAATGAAACTA
GGTACTTGAGAGCCGTGTTGGCTAATGAGAGCATGCTGGC
TCAGCTGTTGTCTAGATTGAGCGGTGTGAACGGCATGAAA
TTTTCTACCTCGCTTTTCCAGGAACCCAATGAGAACGACC
ACGATTATGCCATGCCGATGAAGAGGGTGAAGGTGGAAGA
CAAAGAAACTGCAGGTGGCGTCTGCCTGCATGTGGACAAA
GACCATGTCTCGGTGGAATTCTGCACCAAGTGTGCAGAGA
GTTCAAGCTTGTCACATAAAATGTGCTTGGTCCGCCCATG
CTGAACGACCGGGTCACAGAACATCCATGACTGCTGAAAT
CCATGGTAAGGATCAAGATATTGAAGACTGCACAGAACTG
GTTAACTCCTAAGATGAAGACAGTGCTTTTTGCCAGTTCA
CGGCACAATATCAACTGTAAATAAGCTTAAATTTAGCTTT
TTTTTTTTTCATTTGTTTTGTTTAGATTTATTTACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations