Transcript

crebzf-202

ID
ZDB-TSCRIPT-131113-3016
Name
crebzf-202
Previous Names
  • crebzf-001
  • ch73-201p13.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059415 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059415|OTTDARG00000041182|ZDB-GENE-030131-8015 crebzf|OTTDARP00000046321 CH73-201P13.1-001 LG_ CU896603.6 Danio rerio protein_coding KNOWN, 2612 bp
GAGTCGCCATTTTAGTTTATCTCAGTGTCGTTGCGAGCGC
GTTTCTCCTACATTGGCTCGACAACGGCTGAAGTTAAAAC
ATTTTTATGTCTTGTTAAATCGGTTTATTCGCATTTTTTC
AAGACCAGTCGACACTTAAAGACATCAGTGTACAATTTAA
GTGTTCTCAATATCCTGAAACACGAACATGATCACCAGAA
AAAGAGGAAGAAGCAGCATTAACACAAATACCACATGTTC
AAGCACTTCCCATGAGACTGTTGACGCTTCAAAAACCAGT
AGTGCAAGTGAAACAAACACGCACACCTCTCCAGAAAGCG
ACACCAACGATTGGGGCTTGGATGATCTGCTTGGCTCCGA
GTTCAACTGGGACCTGGACAAGGATATGCTTGAAGCTTTC
AGCAGCTTTGAATCGCAGACATCAGTCTACAATGAAACAA
TCCAAAGTGCAGAGCTTGATGTTTCCGCATCACGTATGGT
CCAGAGGTCAAAACTACTAGACGTCTCCGGCCGGATCATC
AACAAGAACGCCATAGCTGCAAGGATAAACCGATTAAAGA
AGAAAGAATACGTCAGTGGCTTGGAGCAGAGAGTTGGCTC
TTTGACTACAGAAAACCGCGTGCTCAAGCAGGAAAACGGA
AATCTCAACAAGAGAGTGGAAGAGTTGGAGAATGAAACTA
GGTACTTGAGAGCCGTGTTGGCTAATGAGAGCATGCTGGC
TCAGCTGTTGTCTAGATTGAGCGGTGTGAACGGCATGAAA
TTTTCTACCTCGCTTTTCCAGGAACCCAATGAGAACGACC
ACGATTATGCCATGCCGATGAAGAGGGTGAAGGTGGAAGA
CAAAGAAACTGCAGGTGGCGTCTGCCTGCATGTGGACAAA
GACCATGTCTCGGTGGAATTCTGCACCAAGTGTGCAGAGA
GTTCAAGCTTGTCACATAAAATGTAGGGTCAAGTATTTTA
CCTTTTCACCGTTTCCAAGACTGAACTTTACACAAGATGT
AAATGAGGGGACATGACGACAGTAGTCGTCAAAGATAGTT
AACTGTTTAAATATGCAGAGCTTGAATAGCATGTCTGTTG
AACTTGCTTTCAATACAAGTTACTGCTAAACTTGTTGACA
GTTTTCTTCTAGGTGCTTGGTCCGCCCATGCTGAACGACC
GGGTCACAGAACATCCATGACTGCTGAAATCCATGGTAAG
GATCAAGATATTGAAGACTGCACAGAACTGGTTAACTCCT
AAGATGAAGACAGTGCTTTTTGCCAGTTCACGGCACAATA
TCAACTGTAAATAAGCTTAAATTTAGCTTTTTTTTTTTTC
ATTTGTTTTGTTTAGATTTATTTACAGAAAGAGAAAAAAA
ACATTGTTTTGAGTTGTATACATGGATGTTTATTGGAATA
CACAATCATATTATGTAATTGCAGATAAAATAGACAGGGA
ATTAAGTGAATAAAAAAAAAGTATAAAATATAAGTTGGTG
ATGTTTCACAAAGGGCTTTCATCTATAATATTAACAACAT
ACCCATTCAGCGGTCATGTGTAAAAGTTGATTTCAACAAG
TTCTTTAATTTTGCCATAAACATTTGAGCCCTTTCTGAAA
TATCACTGTTTTTCTAAAGAATGTTTTTCATGTAGAACCC
TTATTTTTCTTTATGCTAAAGTGGATTTTGCTGTGGGGGA
AAACAGAAGAGTCGGGACCTGCAGCTTGCATCATGGCCTG
GTAAATTTAAGAAAGGTAGTACATGAAAGTGTAAGTTACT
GCTTTTACTGACTCTTATCACACCCCTAAAGATGTCAGAT
GCTGATGTATTCATTTAGCATCTAAATGAGTATTGAAAAA
GTCTTGTTTTAATGTATGGTAACAAGACATTGAACGACTA
TGTTAAATCCATGTGTTTCATTTTGATTTAACTTTTTGGG
GTGTTTTCTATAAGTTGCCCTGATTCGAGTTAAAGAAATG
GCATGTTCTTGAAGGGTTATGGTTTCTTAATAATGCTCAT
CTATATGTTATATGTATTAAAATTCCAAAGACTATGCAGG
CACATGGCTGCATCTGTTCTGAAAAAAAATGTAATAAATT
TTCATTTGATAAATGCAAATTGCTTTGTGTCCTCTTAAGA
TATTAACTACACTCTCCTTCTCTTTTTAGACAGCAATTTC
TTCGCTCTCTACAAGAGCCTTTTCTTGCCTCTGCAAGGTG
GATAAAGAGTGGTGGTGGTTTCTCCCAGATATATTCAAGT
GTATACTGCACAATTCCTTAATGGTACTGGTAATTCAGTA
ACCTCAAAAAAAAAAAAAAAAAAAAAAAGTACACCTATTC
TGCTTGGGTTCTTAATGTCCCAGTTTATGGCTGTGACTCT
AGCAATGCAGATCAACCCAAGCTGTTCTGAAATGTATAAC
TATGCAGTCTAAATTGTTTTGTTCCTGTCCAGTACTTCAT
ACTGGTGTCAGTGTAAATGGGCGGAAAAGACTTTCCAAAA
GTCTCTTATGAACTATTGGGTCAATGCTGTTAATGTCTGT
GAAATCAAAATTTACAATGTTTAGTTTGCAAGTGCACTTT
GGTTAATAATTGGTTTAAGTTAATCCCTTAAAATAAAAAT
GTTTGTTTTGGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations