Transcript

crebzf-203

ID
ZDB-TSCRIPT-131113-1416
Name
crebzf-203
Previous Names
  • crebzf-002
  • ch73-201p13.1-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059417 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059417|OTTDARG00000041182|ZDB-GENE-030131-8015 crebzf|OTTDARP00000046323 CH73-201P13.1-002 LG_ CU896603.6 Danio rerio protein_coding KNOWN, 1157 bp
AGGTACTTGAGAGCCGTGTTGGCTAATGAGAGCATGCTGG
CTCAGCTGTTGTCTAGATTGAGCGGTGTGAACGGCATGAA
ATTTTCTACCTCGCTTTTCCAGGAACCCAATGAGAACGAC
CACGATTATGCCATGCCGATGAAGAGGGTGAAGGTGGAAG
ACAAAGAAACTGCAGGTGGCGTCTGCCTGCATGTGGACAA
AGACCATGTCTCGGTGGAATTCTGCACCAAGTGTGCAGAG
AGTTCAAGCTTGTCACATAAAATGTAGGGTCAAGTATTTT
ACCTTTTCACCGTTTCCAAGACTGAACTTTACACAAGATG
TAAATGAGGGGACATGACGACAGTAGTCGTCAAAGATAGT
TAACTGTTTAAATATGCAGAGCTTGAATAGCATGTCTGTT
GAACTTGCTTTCAATACAAGTTACTGCTAAACTTGTTGAC
AGTTTTCTTCTAGGTGCTTGGTCCGCCCATGCTGAACGAC
CGGGTCACAGAACATCCATGACTGCTGAAATCCATGTGGA
TTTTGCTGTGGGGGAAAACAGAAGAGTCGGGACCTGCAGC
TTGCATCATGGCCTGGTAAATTTAAGAAAGGTAGTACATG
AAAGTGTAAGTTACTGCTTTTACTGACTCTTATCACACCC
CTAAAGATGTCAGATGCTGATGTATTCATTTAGCATCTAA
ATGAGTATTGAAAAAGTCTTGTTTTAATGTATGGTAACAA
GACATTGAACGACTATGTTAAATCCATGTGTTTCATTTTG
ATTTAACTTTTTGGGGTGTTTTCTATAAGTTGCCCTGATT
CGAGTTAAAGAAATGGCATGTTCTTGAAGGGTTATGGTTT
CTTAATAATGCTCATCTATATGTTATATGTATTAAAATTC
CAAAGACTATGCAGGCACATGGCTGCATCTGTTCTGAAAA
AAAATGTAATAAATTTTCATTTGATAAATGCAAATTGCTT
TGTGTCCTCTTAAGATATTAACTACACTCTCCTTCTCTTT
TTAGACAGCAATTTCTTCGCTCTCTACAAGAGCCTTTTCT
TGCCTCTGCAAGGTGGATAAAGAGTGGTGGTGGTTTCTCC
CAGATATATTCAAGTGTATACTGCACAATTCCTTAATGGT
ACTGGTAATTCAGTAACCTCAAAAAAAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations