ZFIN ID: ZDB-TSCRIPT-131113-4421
Transcript Name: nf1a-203
Previous Name: nf1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057587 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057587|OTTDARG00000040134|ZDB-GENE-030131-4907 nf1a|OTTDARP00000045118 nf1a-001 LG_ BX000438.7 Danio rerio protein_coding KNOWN, 11386 bp
GGGAGAGAGAGAGTGAGGAGGATTCAAACTTCCGGTGGTG
TGTCATGGCGGCGTGGTGGAGTATGCTTGAAGTGAAAAAC
TAAACCAAACCCCCCTCCTCCCTCCACCTCCTTCTCCGTT
CTCCTCCTTGATTATTTTGCGGAGCGGTTTAGGGGGTATT
TGGAGCACCCGGGACGATTCGGGAGCAGGAATCGGGATCG
CAAAAGTGATTGATAGGAGACATAGCGGCGCGCGCATCCG
CCTGAGCATGGCGGCGCACAAGCCCGTGGAATGGGTCCAG
GCCATCATTAACAGATTCGACGAACAGCTCCCAATCAAAA
CAGGACAGCAGAGCACCCACACCAAAGTGAGTACAGAGCA
CAACAAAGAATGTTTGATCAACATCTCCAAGTACAAATTT
GCCCTCGTCATCAATGGCCTGACCAACATACTCAAAAATG
TGAACAACATGCGGATATTTGGCGAAGCTGCTGAGAAGAA
CCTCTACTTCTCCCAGCTGATCATACTGGACACACTGGAG
AAGTGTCTAGCAGGGCAACCTAAGGATTGCCTGAGGCTGG
ATGAGGCTATGTTGGTAAAACAGTTGCTGCCTGAAATCTG
TCACTTCCTGCACTCGTACCGTGAGGGCCAGCAACACGCC
ACTCAGCTGCGCAGCTCCGCCTCTGCTGTGCTTTTCTCTC
TCAGCTGCAACAACTTTAATGCCGTCTTCAGTCGTATCTC
CACCAGGTTGCAAGAGCTCACAGTTTGTACAGAGGACACA
GTGGATGTCCATGACATTGAGCTCATTCAGTATATCAATG
TAGATTGCTCCAAGTTAAAGAGACTCCTACAAGAAGCAGT
ACTTAAGTTCAAGTCTTTGAAAAAGCCGGCTCAGCTTGCA
GTAATCAGCAGTTTGGAAAAGGCTTTCTGGAACTGGGTTG
AACACTACCCTGATGATTTCACTATGCTCTATCAGAGACC
CCAGGCCGACATGGCCGACTGTGCAGAGAGACTGTTCGAC
CTAGTGGACAGTTTTGCGGAAAGCGCAAAGAGAAAAGCTG
CTGTGTGGCCACTGCAGATCATCCTCCTCATCCTCTGTCC
AGAGATCACGCAGAGCATCACCAAAGAAGTAGGGGGAGAG
GAGAAAGCTAACAAGAAGTCATTTGTAGACAGTTTACGAA
AGGCTCTTGGCCAACACAGCGGCAGCAAACAATTGACGGA
AAGTGCAGCTGTTGCATGCGTCAAACTCTGCAAAGCCTGC
ACATATATCAACTGGGAGGATAATTCTGTCATCTTTCTCC
TGGTTCAGTCCATCGTCATGGACCTTAAGGGTCTCCTGTT
TAACCCCACCAAACCTTTCTCAAGAGGTACGGGCTGCCAG
AGCGCCGATGTAGATTTGATGATCGACTGCTTTGTGTCAT
GTTATCGCATCAATCCTCGCAACAACCAGCATTTTAAGGT
GTGTCTGGCCTCGACTTCTCCTCCTACCTTCCATTTCGTC
CTTGTCAACTCCCTGCACAAAATTATCACAAATTCTCACC
TGGACTGGTGGCCGAAGATTGACGCCATCTACTGCTACTC
AGGAGAACTACGCACCATGTTTGCAGACACACTGGGTCGA
GTGATTCAGAGTCTCAGTGCACATCCGCCTCTGAGGATGA
CATCAAGTTTGACATTCAAAGAGAAAATGACAACAAGTTT
GAAGTTCAAGGAAAAGTCCACAGATCTTGATTCGCGTTCT
TTGCTGCTGGCACTGGTCAAACTTATCCACGCTGACCCCA
AACTAATGCTGCACAATCCGGGAAAACCTGGTCAGGAGAT
TCAGAACAGCACAGCTGAGATCATCAAAGGTCTGGTTCAG
CTGGTTCCTCTTACCCACAGTGCTGAGCTTTCCCAAGAGG
CCATGGAGGCATTGCTTGTTTTACATCAGCCAGAAACCAT
TGAGCTATGGAACCCGGACGCTCCCATTGAGACCTTCTGG
GACATCAGCTCTCAGGTGTTATTTCTAATTTGTAAGAAGC
TGATTGGACACCAGATGATCAACAGTACAGAGATACTCAA
GTGGCTCAGGGAGATTCTCATATGCAGGAACAAGTTTCTA
TTAAAGAACAAGGAGTGTGCTACACAGGGCAGTCTGATCC
CCATCAGCAGACAGGCTCAGACCAAGCTGGAGGTGTGTCT
GTACACGTTCCTGTGGAGTCCTGATGCAGAGGCTGTTTTG
GTGGCCATGTCCTGTTTCAGGCATCTCTGTGAGGAGGCCG
ATATTCGCTGCAGTGTCGATGAGCTGCCTGTTCACACAGT
CCTACCCAATTACAACACCTTCATTGAGCTTGCATCCGTC
AGCAATATGATGGCCACAGGTCGCAACACACTACAAAAAA
GAGTGATGGCACTTTTAAGAAGAATAAAGCACCCTACAGC
TGGAAATGTAGAGGCATGGGAAGACACATATGCAAAGTGG
GAGCAAGCTACAAAACAGATACTCAACCACCCAAAAAACA
AAGTGGAAGATGGACAGGAGTGGATCAACATGACTGGTTT
CTTGTGCGCTCTGGGAGGTGTTTGTCTCCAACAGCGCAGC
ACGCCGAGTCTGGGCACCTACAGTCCTCCAATGGGCCCCC
TGACCGAACGCAAGGGGTCCATGATTTCCATGAGCTCCTG
CGAGGTAAACAGCGAAACATCCCTGAATCGCTTTCTGGAG
CGTCTGCTGGCTCTGATGGTCTGCACACATGAGAAAGTGG
GAGTGCAAATTCGCACCAACGTCAAAGACCTGGTGGGACT
GGAGCTCAGTCCGGCTCTCTATTCAATGCTCTTCACTAAG
CTGCGCAACAGCATCGGACGCTTCTTTGACACCCAGGGGC
CGGTTCCTATTACAGATGCAAACACTCTGTTTGTAGAGCA
GACCATTGCTATCATGAAGAACTTGCTGGACAGTCACACT
GAAGGAAGCTCAGAGCACCTTGGTCAAGCCAGCATTGAGA
CCATGATGCTCAATCTAGTTAGGTATGTGCGTATTTTAGG
GAACATTGTTCATGCCATTCAGATCAAAACCAAGTTGTGT
CAGTTAGTGGAGGTGATGATGGAGCGCAGGGATGACCTCT
CCTTCTGCCAGGAGATGAAATTCAGGAATAAAATGGTGGA
GTACCTCACAGACTGGGTGATGGGAACCTCCAATCAAGCT
GCGGACGATGATGTCAAATGCCTGACCCGCGATCTGGACC
AGGCCAGTATGGAGGCTGTCGTGTCTCTGTTGGCTGGTCT
TCCTCTACAGCCTGAGGAGGGTGACGGTGTTGAGCTCATG
GAGGCCAAATCACAGCTCTTCCTGAAGTACTTCACACTGT
TCATGAACCTGTTGAATGACTGCAGCGAGGTTGAGGAAGA
TGGCCAGCAGGTCGCAGGGAGGAAACGTGGCATGTCTAGA
CGACTGGCATCTCTGCGGCACTGCACAGTATTGGCTATGT
CTAACTTGCTCAATGCTAATGTGGATAGCGGCCTCATGCA
CTCAATCGGTCTGGGATACCATAAGGACCTGCAGACACGG
GCTACATTTATGGAAGTGCTCACTAAGATCCTTCAGCAAG
GGACGGAGTTCGACACGCTTGCAGAGACTGTGCTTGCAGA
TCGCTTTGAGAGACTGGTCGAGCTGGTCACCATGATGGGA
GATCAGGGAGAGCTGCCCATAGCCATGGCTCTGGCCAATG
TGGTCCCATGCTCTCAATGGGATGAGCTGGCCAGAGTGTT
AGTGACTCTCTTCGACTCTCGCCATCTGCTGTATCAGCTG
TTGTGGAATATGTTCTCCAAAGAGGTGGAGCTGGCAGACT
CAATGCAGACGCTCTTTAGAGGAAATAGCCTAGCCAGCAA
GATTATGACCTTCTGCTTCAAGGTGTACGGAGCTGCGTAT
CTACAGAAGCTTCTGGAGCCGCTGTTGAGAGGAATCATCA
CTACACCAGAGTGGCAGCAGATCAGTTTTGAAGTGGACCC
TACTAGACTTGAACAGGCAGAGAACCTGGAGGAGAACCAG
AAGAACCTGCTTCAGATCACTGACCGCTTCTTCCTGGCCA
TCATCAACTCCTCGAGCGAGTTTCCTCCACAGCTGCGCAG
TGTGTGCCACTGTCTGTATCAGGCTACTTGCCACTCCCTT
CTGAATAAAGCCACTGTTAAAGAAAAAAAGGAAAACAAAA
AATCCGTGGTCAGTCAGCGGTTTCCTCAGAACAGCATTGG
TGCTGTAGGAAGTGCCATGTTCCTGCGCTTTATTAACCCA
GCTATCGTGTCCCCATATGAGGCTGGAATCCTAGACAAGA
AACCCCCACCTCGCATCGAGCGTGGCCTTAAACTCATGTC
TAAGATTCTGCAGAGCATTGCTAATCATGTTCTCTTCACA
AAAGAGGAGCATATGAGGCCCTTTAATGATTTTGTCAAAA
GCAACTTCGATGCAGCCAGAAGGTTCTTCTTGGATATCGC
ATCTGATTCTCCACCAAGTGATTCTGTGAACCATAGTCTG
TCTTTCATCAGTGACGGTAATGTGCTCGCTCTGCACCGGC
TATTATGGAACAACCAGGAAAGAATTGGCCAATACCTGTC
CAGCAACAGGGACCACAAGGCAGTGGGCCGTAGACCATTT
GACAAGATGGCCACTCTTCTGGCGTACCTGGGTCCTCCTG
AACATAAGCCAGTAGCAGACACACACTGGTCCAGCCTCAA
CCTCACCAGCTCAAAGTTTGAGGAGTTCATGACAAGGCAT
CAAGTCCATGAGAAGGAGGAATTTAAAGCATTAAAAACCC
TCAACATATTTTACCAAGCTGGCACATCTAAGAACGGCAA
CCCTGTGTTTTATTACATCGCACGCAGGTTCAAAACTGGA
CAAATCAATGGTGATCTTCTGATCTACCACGTCCTGCTGA
CGCTCAAGCCCTACTATGCCAAGCATTATGAGATCGTAGT
TGACCTTACTCATGTGGGCCCCAGTAACCGTTTCAAGACG
GACTTCTTATCCAAATGGTTTGTGGTCTTTCCAAACTTCG
CCTATGAGAACGTGGCTGCTGTGTACATCTACAACTGCAA
CACCTGGGTACGCGAGTACACCAAATACCACGAGCGACTG
CTGACTGGCCTCAAGGGGAGCAAGAAGCTGGTGTTTATCG
ATTCGCCTGCACGTCTAGCTGAACACATCGAACCCGAACA
GCAGAAGCTGCCCGCAGCTACTTTAGCACTGGAAGAAGAC
CTCAAAGTGTTCCACAACGCCCTAAAGCTTGCACACAGAG
ACACAAAAGTGTCAATTAAGGTGGGATCCACAGCTGTACA
GGTGACCTCGGCCGAAAGAACGCGTGTCCTAGGACAGCCT
GTGTTCCTAAATGACATCTACTACGCTTCAGAGATCGAGG
AGATATGCCTGGTGGACGAGAACCAGTTCACGCTAACCAT
CGCTAACCAGGGCACCCCACTCACTTTCATGCACCAGGAG
TGTGAAGCCATCGTTCAGTCCATCATCCACATCCGCACGC
GCTGGGAACTTTCCCAACCAGACTCCATTCCCCAACACAC
CAAAATCAGGCCTAAGGATGTTCCTGGCACCCTGCTCAAC
ATCGCTCTTCTCAACCTGGGAAGCTCCGACCCCAGTCTGA
GGTCTGCGGCCTACAATCTCCTTTGTGCCTTAACCTGCAC
CTTCAACCTGAAGATTGAAGGCCAGCTTCTGGAAACGTCT
GGCTTGTGCATCCCAGCCAACAACACGCTTTTTATTGTGT
CCATTAGCAAAACGCTAGCAGCTAATGAACCCCACCTCAC
TCTGGAGTTCCTGGAAGAGTGCATCTCAGGATTCAGTAAA
TCAAGTATAGAGCTGAAGCATCTGTGTCTAGAATATATGA
CTCCTTGGCTCCGTAATTTGGTGCGCTTTTGCAAACACAA
TGATGACGCCAAACGGCAGCGTGTCACGGCCATCCTGGAC
AAGCTTATTACTATGACCATCAACGAGAAGCAGATGTACC
CCTCCATACAGGCCAAGATATGGGGCAGCTTGGGTCAGAT
CACAGACCTGCTTGATGTGGTGTTGGACAGCTTTATAAAG
ACCAGCGCTACTGGCGGTTTAGGATCCATCAAAGCTGAAG
TGATGGCTGACACTGCTGTAGCTTTGGCGTCAGGAAATGT
CAAACTGGTCTCCAGCAAGGTGATTGGCCGAATGTGTAAG
ATCATCGACAAGACGTGTCTGTCTCCCACTCCGACCCTTG
AGCAGCACCTCATGTGGGACGACATCGCCATCCTGGCCCG
GTACATGCTCATGCTGTCCTTCAACAACTCTCTGGACGTG
GCCGCTCATCTGCCATACCTGTTCCACGTCGTCACCCTGC
TGGTGGCCACGGGCCCTCTCTCGCTGCGTGCATCAACACA
CGGCCTGGTCATCAACATCATTCACTCGCTCTGCACATGC
TCACAACTCAACTTCAGTGAGGAGACTAAACAGGTGCTGC
GCCTGAGTCTGACTGAGTTCTCCCTGCCCAAGTTCTACCT
GCTGTTCGGCATCAGTAAGGTCAAATCTGCGGCGGTCATC
GCTTTCCGTTCCAGCTACAGAGACCGCTCATTCTCTCCAG
GCTCTTATGAGAGAGAGACATTTGCTCTGTCTTCCCTGGA
AACAGTCACGGAGGCTCTTTTGGAGATCATGGAGGCCTGC
ATGAGGGACATTCCTGGATGCAAATGGCTAGATCAGTGGA
CTGAATTGGCGCAAAAGTTTGCGTTCCAGTATAACCCCTC
TCTTCAGCCTCGGGCGCTGGTGGTGTTCGGCTGCATCAGT
AAACGAGTGACTCACGGACAGCTAAAGCAGATCATTCGTA
TTCTCAGTAAAGCCAGTCCTCTACTCAGCATTGATCGGGG
GCTGGAGAGCTGCTTAAAGGGCCCAGATAATTACAACAGC
CAGGTTCTCATCGAAGCCACAGTCATCGCTCTCACCAAAC
TACAGCCTCTCCTCGATCAGGATTCTCCTATGCATAAAGC
TCTGTTCTGGGTGGCCGTGGCCGTGCTTCAGTTGGATGAA
GTGAATCTGTACTCCGCCGGCACTGCCTTACTGGAGCAGA
ACCTGCACACACTGGACAGCCTCCGAGTGTTTAATGATAA
GAGTCCTGAAGAGGTTTTTATGGAGATCCGGAAACCTCTA
GAGTGGCACTGTAAACAAATGGACCATTTTGTGGGACTCA
ACTTTGCCTCCAACTTCAATTTTGCATTAGTGGGCCATTT
ACTTAAAGGATACAGACATCCCTCTTCAACAACAGTTGCC
AGGACAGTTCGTATCCTGCATACACTCCTGGGCCTGGTGG
GAAAACACCGCAGCTGTGACAAGTTTGAGGTGAACACGCA
GAGTGTGGCCTATCTGGCAGCTTTGCTCACAGTGTCAGAG
GAAGTTAGGAGCCGCTGCAGTTTAAAGCACAGGAAATCAT
TGCTGCTTTCAGAAGTTACAATGGAGAACTTCCCCATGGA
CACATACACCGTTTACGACACTGAACCCGGGTGCAGGCTA
CTGCGTGAAAACCAGCCTTGGGCTTCTCCGAAAGTGTCAG
AGCGCAGTCTTGCACCTCCGTACTCCACAATAGGGCAGAC
CAGCCTTCGTCCACGCAAATCCATGAGTGTAGACATGGGC
CAGCCGTCTCAGGCCAATGCGAAGAAACTACTGGGCACTA
GAAAGAGTTTCGATCACTTAATATCAGAATCCAAAGCCCC
AAAAAGACCAGACATGGAGTCGGGCATCACCACACCTCCA
AAGATGAGGCGGGTTTCTGAAAATGACTATGAGATCGAAA
CTCAGCGAATAGCCAACTCTCATTTACGCAAAGTGTCTGT
GTCTGAATCCAATGTCCTCCTGGACGAGAACGTACTTACG
GACCCCAAGATCCAGACGTTGCTCCTCACTGTACTGGCAA
CACTGGTGAAGTACACTACAGACGAGTTTCATCAGCGGAT
CTTGTATGAGTATTTGGCTGAGGCCAGTGTGGTCTTCCCC
AAGGTCTTTCCAGTTGTGCACAACCTGCTGGACTCCAAGT
TAAGCACCGTCCTTTCCATGTGCCAGGACCCGAACCTTCT
GAACCCCGTCCATGGCATCATTCAGAACGTGGTCTATCAT
GAGGAGTCTCCCCCTCAGTACCAGCCGTCCTGCTTGCAGA
GCTTTGGTTTCAATGGTCTTTGGAGGTTTGCCGGGCCGTT
CTCTAAGCAAACCCAAATTCCAGACTACGCCGAGCTGGTG
GTTAAATTTTTGGATGCTTTGATTGACACGTATCTCCCGG
GCATTGAGGAGGAAGGAGGAGAAGAGTCACTGCGGACCCC
GACCTCGCCATATCCACCAACCGTCCAGAGCCAGCTGAGC
ATCACAGCCAATCTCAACCTGTCCAACTCCATGACATCAC
TTGCCACATCACAGCACTCCCCAGGCATCGACAAGGAGAA
CGTTGAGATTTCTCCCACCTCGAGTCTGTCCACCAGTGGG
CGAATGCGGCACGGCTCAGCAAGCCAGGTGCAGAAGCAGC
GCAGCGCAGGCAGCTTCAAACGGCCAAGCATCAAAAAGAT
CGTCTGAGAAGATCTACTCCGTGGCCATGGCTCGTTCTGC
TTTCCACCGTCCAGTTTAACAAGGTTCCTGCATCGAAGAA
CCGCTTGAGTGTTTGTTTGTTTTTATACCAGTTGAAGCTT
GCCACACACTTTGCCTAAATGAACTCTTTTCGGAGAACAC
ACTGACCTCTCCGTGTTGCACTCAACTTGGGGACTGACCA
CATTGAAATGCTCAAATCTGTCCAGTTGAGGCGTCCACTC
TTTGTTTTTTTGCACAAACTTGAGATTCTGTCTGAAAGAA
ACACAAGATCTAATCAACCACTACAGTAAAAACAGATGAC
CAACCGTGTGGAGATGACTCGGCCGTTTTCCATTTCGTCC
AGGCCTGTCCTTTGTTTTGTTTTTTCCTGATATCCACAGG
CTTGAAATCTGGATCCAGGAAAGATTATGTGTGTACTATA
ATGTTGATGATAATAACGATCACATGTTTTGGGTTCTTAC
TTTATCCATTGTGTGCCTTTGTCAGGGTTTTCAGCTGTGT
ATAGTTTGTAAAATAGGCAAGACCTTGCTAAGGAAGGGAA
AACAGGTACTAATTATGAAAAACAAACGTGTCGCGGCTTT
AACATTTACCATATTGTCTGCTGCAGTGTAAACAGTACAA
CGTAAACATCAGATATGAGAATATCATATTGCGGCATCCA
AGTATTTATTCTGTAAATGTAAGTTATCCTTTCAGACATC
ACATGAAGGTTTGCTTTGCGATCGTTGTTTATCATCAGTC
GTTAAATAAAAAAACGATTCTGGAAGAGCAGCGCATGAGT
AGATACCCACATAGTATTTTCCCAAAATGCACAAATCAAC
AACAAATTGGCATTAATATTCATGTATAACTGTGGTGCAA
TATGTTTTTGTTTTTTAAATCGAACACTATGTGCGTGTAC
AAATTGCACACGATTAAAGTGTGCGATCAGGAAATGTCCG
CGCACACTTTAACTTTCCCCTGTTTCCGTCTCATCAACAG
CTCACATATGGCACAGAAATCCCAATCCAACCACGCGCTG
ACATAGTAACATTGCACCAAAGACTAGTTTGCAATATTAA
GAGGGGAAACTGTTGTAAACTCCATTTTGTATGTTTTTTT
GTTTTTGTATCTGTCTTGTCAGTGCTGTATGCCTTAAAGT
AATTATTTCTTCCATACAGTTCTCATTAGCTTTGGCGTTC
TCACCTAATCAGTATATTGTAGAATTGAAGACAGTTGTGC
CATTTAAAAGGGATAGTTCACCCAGAAATTAAAATATGAT
GTTCATTTATTCACTCTCCAGTCACCTAAGGTGTAGGTGA
CACCTTTGTGTTCTCCATTAAAACATTATAGAAGTTTTAG
TTGAAATTGTCGTCTTTTGTGATTTAAAGTATGCAAGTCA
ATAGCTAAAAGGTGAAATTAAGTTCGATTAATACCCAAGG
CTCCTAATGATACATTGAGGTCTCATATTAAGGCAAGAAC
CTGGAAACTGTATAACATTATTAAGACCTCAATGTATTGA
TGCCTGTATGTGTTTTTGTTTTGACTCATAAATTGCTGTT
GACATGCATTTTATGAATCAACAAAGCTAAAAATCCTCTT
TACTGTTCTACTGAATGGGAAAACAACATTTCCTACATCC
TTGATAACCTGAGGGTGATTAAATAAAAAGCTAATCTTCA
TTTTTGGGTGAACTGTACTTTTAAGATGCTGTTGTGTATT
AAACACAGTGGCTGTCAAAATTGAAGTGGGCGATTTTTGT
GTGCAATATGTTTCCTGCATTATCGTTCTCATTATTATGT
CGATCCACAAATCGTAGAGGAGGAAATGGTAGTGTACCTT
GCAACAAACACAAATGACATGACTTATCGACTCTCTTTGA
AATGCTTATTAAAGGGAAACTTGTAAAGAAGGGTACAGGC
CAAATGTTTGAGGATGAAGTATTTATGCATTATTTTAATT
TGATGTTTTCATCCAAATACACAAGGATCATGTTTCATAC
TTAAAATTGGGACCAAATCAATGTCATTGTTTTTTTTTTT
CATTTGTAGATTTGTTTTACCATTAAACTATTCATAAACA
TTCGTCCATACAGTGAAACATCGTCCCAACAGAAGATTTC
AGATCTCAGTGTTTTGTTACGATCAAAAATGAAACTTGAA
ATGTTTATTCCTGCTTTACATGTCGTACTGGCATCAATCT
GTGTTAAATTGAGTTTTTAATAACGAATTTAAAATATGAA
GGAACATAAATGACCCAATTGTGTGGTTTTGTTTTGCATC
CATTGCTCTGAATAACCAGAATATTACTTTTGAATCTTAG
GAATTGCATTGCTACCAATCTAAAACTGACCTTATATTGA
TAGACAACAATAACGAAGGCACAGTCTTGACTGCCACAGC
TGTGGTTTGACACGACATGTCCCTAAAGCCTTTTAAATCA
CATATGTAATTAAACCGTCTCATGTATTCATCATAAACAG
ACTAAAAAGTGGTTTATTTTATATAATTGAAGATGCGTGT
TCGTCGGATGCATTTGCCACATTTTTAATTGCATTGGTCA
TCTGTATACAATGTATCTGTCACCTGTAAATATGTTTGTG
TAAAATTGGAAGGTATATAAATACAAGTGTAAATATATGT
GATATTGTATTACTTGCTTTTTTGTAAAGCGGTTAGTTGC
TGTACATGTATAACATGGCAATTTAATTATACCAGTGTTC
GTAATAAAAGTTTCCCTCAACCCTGTTATTATGCCGTTCA
GTCAATTTTATTATCCATGATTTTTAACGACAAAGAAATG
TGTTGAATTAATGGAAAGTTACCTGCATCACTTATTCGTC
ATGTCATAGAATTTCCACAGCAACCT

nf1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA nf1a-202 (1) 689
nf1a-203 11386
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nf1a-203 Contained in:
OTHER nf1a-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000057587 (1)
  • Ensembl_Trans:ENSDART00000157005 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN024089 (1) 890bp
    GenBank:CT603894 (1) 700bp
    GenBank:AW174847 (1) 692bp
    GenBank:CR929257 (1) 539bp
    GenBank:EB780896 (1) 218bp
    CITATIONS (2)