ZFIN ID: ZDB-TSCRIPT-131113-1225
Transcript Name: nf1a-202
Previous Name: nf1a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057588 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057588|OTTDARG00000040134|ZDB-GENE-030131-4907 nf1a|OTTDARP00000045119 nf1a-002 LG_ BX000438.7 Danio rerio protein_coding KNOWN, 689 bp
GTCGGCTGTATTCCCACCTCACCTCGTCCTGCCAGGCATC
GACAAGGAGAACGTTGAGATTTCTCCCACCTCGAGTCTGT
CCACCAGTGGGCGAATGCGGCACGGCTCAGCAAGCCAGGT
GCAGAAGCAGCGCAGCGCAGGCAGCTTCAAACGGCCAAGC
ATCAAAAAGATCGTCTGAGAAGATCTACTCCGTGGCCATG
GCTCGTTCTGCTTTCCACCGTCCAGTTTAACAAGGTTCCT
GCATCGAAGAACCGCTTGAGTGTTTGTTTGTTTTTATACC
AGTTGAAGCTTGCCACACACTTTGCCTAAATGAACTCTTT
TCGGAGAACACACTGACCTCTCCGTGTTGCACTCAACTTG
GGGACTGACCACATTGAAATGCTCAAATCTGTCCAGTTGA
GGCGTCCACTCTTTGTTTTTTTGCACAAACTTGAGATTCT
GTCTGAAAGAAACACAAGATCTAATCAACCACTACAGTAA
AAACAGATGACCAACCGTGTGGAGATGACTCGGCCGTTTT
CCATTTCGTCCAGGCCTGTCCTTTGTTTTGTTTTTTCCTG
ATATCCACAGGCTTGAAATCTGGATCCAGGAAAGATTATG
TGTGTACTATAATGTTGATGATAATAACGATCACATGTTT
TGGGTTCTTACTTTATCCATTGTGTGCCTTTGTCAGGGTT
TTCAGCTGT

nf1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA nf1a-202 689
nf1a-203 (1) 11386
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nf1a-202 Contained in:
OTHER nf1a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000057588 (1)
  • Ensembl_Trans:ENSDART00000154448 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT640924 (1) 694bp
    CITATIONS (2)