ZFIN ID: ZDB-TSCRIPT-131113-4330
Transcript Name: zgc:174895-203
Previous Names: dkey-81n5.6-002, zgc:174895-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057109 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057109|OTTDARG00000039823|ZDB-GENE-070928-41 zgc:174895|OTTDARP00000044786 DKEY-81N5.6-002 LG_ CR855391.6 Danio rerio protein_coding NOVEL, 915 bp
TAGGCTATCATTTTAGATCATCCGTTTAAAACAGCTTTAA
GATGACAAAACACCACAAACTGAAGATTTTCGCTATTATT
CTGTACACGAATCCTATTCACATTATTCACTGTTGGTGGA
AAAGGAAAGCTGCATGTATTCCGCTGAGTAAACAAACACT
AAACAGTGTGGGTCTGGTCTGACCCAATGGCTAAGCGATT
GCTCTGGGAGAGACGTGAAAACGCCCACTTCAGACTTGTT
GAACTCGACACCAAATTACATTCCGTTACTGGAGCGAGTT
TGCAGAAGTCTATAGAGCTCTTGTCAGAATGGATGTTTTA
GCAGTTCCCCCAAAAAGAGAAGAGGGCTGGTACTTGTCTC
TTATGGCACCAAACACAAAAGGACCAAAGTTTGCATGGCT
TGATCCATCAAGACTCTATTGCAATTCCCAGAATGAGACC
ATTGACCTGGTGGCTGGAATAGATGCCATGGGCTTCATCC
TCGGGTCAGCTGTAGCCACAACATTGGGAAAAGGATTTCT
GGCTATTCGTAAAGCAGGACACTTATGTGTTGAAACTCAC
ACTCAGGACTACAGTGACTATTCTGGACGAGAGAAAGTCA
TGGAAGTGCGTGTTGATGTGTTAAAGCCAGGCTTACGGGT
TCTTTTAGTAGACCAGTGGATCGAGACGGGAGGAACTATG
AGAGCTGCTATCAAACTGGTGGAGAATCAAGGAGCTACTG
TTGTAGGTATTGCTGCTGTGGCCATTGAAAACAGTGAAGG
AGGAAAATGGCTGAAGGAAAACTATAAATATTCCCACTGC
ATTCCGAAAGAGCTGCAATCTCAAATAGACAGTCAATATC
TGGAGTTCTTCAAGAACTTCAGTGTTTAAAGGCATGACAA
TCAGGTACATATTCAAGTGGAATGTAATATTTGAT

zgc:174895 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:174895-201 (1)    Ensembl 1850
zgc:174895-202 (1)    Ensembl 984
zgc:174895-203 915
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:174895-203 Contained in:
[BAC] DKEY-81N5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000057109 (1),  Ensembl_Trans:ENSDART00000156835 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EG571663 (1) 890 nt
CITATIONS (2)