ZFIN ID: ZDB-TSCRIPT-131113-2734
Transcript Name: zgc:174895-201
Previous Names: dkey-81n5.6-001, zgc:174895-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057108 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057108|OTTDARG00000039823|ZDB-GENE-070928-41 zgc:174895|OTTDARP00000044785 DKEY-81N5.6-001 LG_ CR855391.6 Danio rerio protein_coding NOVEL, 1850 bp
TTAACACAAAGACAACGGAGCGCATTAAGAGCAATGTTAT
GAGTTATTAAACTATTGGGTAATCACGTTACCGTTACATT
TGTCATCATTAGGTAGGCTATCATTTTAGATCATCCGTTT
AAAACAGCTTTAAGATGACAAAACACCACAAACTGAAGAT
TTTCGCTATTATTCTGTACACGAATCCTATTCACATTATT
CACTGTTGGTGGAAAAGGAAAGCTGCATGTATTCCGCTGA
GTAAACAAACACTAAACAGTGTGGGTCTGGTCTGACCCAA
TGGCTAAGCGATTGCTCTGGGAGAGACGTGAAAACGCCCA
CTTCAGACTTGTTGAACTCGACACCAAATTACATTCCGTT
ACTGGAGCGAGTTTGCAGAAGTCTATAGAGCTCTTGTCAG
AATGGATGTTTTAGCAGTTCCCCCAAAAAGAGAAGAGGGC
TGGTACTTGTCTCTTATGGCACCAAACACAAAAGGACCAA
AGTTTGCATGGCTTGATCCATCAAGACTCTATTGCAATTC
CCAGGCACTGTCAGATTGTGTAAAAGATCTTCTCAAACCA
TTCCAGAATGAGACCATTGACCTGGTGGCTGGAATAGATG
CCATGGGCTTCATCCTCGGGTCAGCTGTAGCCACAACATT
GGGAAAAGGATTTCTGGCTATTCGTAAAGCAGGACACTTA
TGTGTTGAAACTCACACTCAGGACTACAGTGACTATTCTG
GACGAGAGAAAGTCATGGAAGTGCGTGTTGATGTGTTAAA
GCCAGGCTTACGGGTTCTTTTAGTAGACCAGTGGATCGAG
ACGGGAGGAACTATGAGAGCTGCTATCAAACTGGTGGAGA
ATCAAGGAGCTACTGTTGTAGGTATTGCTGCTGTGGCCAT
TGAAAACAGTGAAGGAGGAAAATGGCTGAAGGAAAACTAT
AAATATTCCCACTGCATTCCGAAAGAGCTGCAATCTCAAA
TAGACAGTCAATATCTGGAGTTCTTCAAGAACTTCAGTGT
TTAAAGGCATGACAATCAGGTACATATTCAAGTGGAATGT
AATATTTGATTTACATTTCGCTTTGACAGGATTTAAACAT
TGCCAATAAATCCTCACTGTAAAACATGTATACAGCACTG
ATTTTATATTGCTGGTATTAAATGTAGAAAGTGCCATATA
AATCGAAATATAATATTTTAATACACATCTATGTTTTGTT
TCTATTTCTATAATTATAATAATGATAATATAGATGGGTT
TTACATTTACATGACATGTCCAGATGTGTTACATATACAC
ATTCATATGAGATAGACAAAATCTAAAATTGAGATTTAAG
GTTACCCCAATTAAAAATAGTTTTCAAATGTTTTTACTTC
ACATGACAGTATATTTCACTTAAGAATTTAATAACTGTAC
ATGTAATATTGCTGCAAATGATTCAGCTCAAACGTAGTGA
CATGCAATTGTGCACCATGCCATTCTAAACTTGATATTAT
ATCATATTGGAAATAAACCAATTTGTGTATGGTTGTTACA
CAAAAATACCAATAGAGGACGCTATCACACTGTAACTGAG
ATTTCTAACTTGAAACCGGTAAATTTATCAGTGGTTTAAT
CTTTTAATCAAACAACATTAATACAGTAATAACATTAAAA
AAGGCGTATTTCACTTTACGTGAGAGGTTTTTAAATAAAT
AAATGGCTCATTAAAAAAAGAAAAGCATTTTATTTATAAT
AAAATTGCTGGTCACAGAAAACTACCATCTGTATGTAAGC
CCTAATACTTATAAAGTTTTACAGCAAGATGAAGCTATAT
AAAGGAATTCCTATACAACTTCCATTTTAATAAACAGCAC
TTTTGATATA

zgc:174895 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:174895-201 1850
zgc:174895-202 (1)    Ensembl 984
zgc:174895-203 (1)    Ensembl 915
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:174895-201 Contained in:
[BAC] DKEY-81N5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000057108 (1),  Ensembl_Trans:ENSDART00000109004 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC153666 (1) 1515 nt
GenBank:DR714967 (1) 839 nt
GenBank:EH571286 (1) 773 nt
CITATIONS (2)