ZFIN ID: ZDB-TSCRIPT-131113-1136
Transcript Name: zgc:174895-202
Previous Names: dkey-81n5.6-003, zgc:174895-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057110 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057110|OTTDARG00000039823|ZDB-GENE-070928-41 zgc:174895|OTTDARP00000044787 DKEY-81N5.6-003 LG_ CR855391.6 Danio rerio protein_coding NOVEL, 984 bp
GCAGAAGTCTATAGAGCTCTTGTCAGAATGGATGTTTTAG
CAGTTCCCCCAAAAAGAGAAGAGGGCTGGTACTTGTCTCT
TATGGCACCAAACACAAAAGGACCAAAGTTTGCATGGCTT
GATCCATCAAGACTCTATTGCAATTCCCAGGCACTGTCAG
ATTGTGTAAAAGATCTTCTCAAACCATTCCAGAATGAGAC
CATTGACCTGGTGGCTGGAATAGATGCCATGGGCTTCATC
CTCGGGTCAGCTGTAGCCACAACATTGGGAAAAGGATTTC
TGGCTATTCGTAAAGCAGGACACTTATGTGTTGAAACTCA
CACTCAGGACTACAGTGACTATTCTGGACGAGAGAAAGTC
ATGGAAGTGCGTGTTGATGTGTTAAAGCCAGTAGACCAGT
GGATCGAGACGGGAGGAACTATGAGAGCTGCTATCAAACT
GGTGGAGAATCAAGGAGCTACTGTTGTAGGTATTGCTGCT
GTGGCCATTGAAAACAGTGAAGGAGGAAAATGGCTGAAGG
AAAACTATAAATATTCCCACTGCATTCCGAAAGAGCTGCA
ATCTCAAATAGACAGTCAATATCTGGAGTTCTTCAAGAAC
TTCAGTGTTTAAAGGCATGACAATCAGGTACATATTCAAG
TGGAATGTAATATTTGATTTACATTTCGCTTTGACAGGAT
TTAAACATTGCCAATAAATCCTCACTGTAAAACATGTATA
CAGCACTGATTTTATATTGCTGGTATTAAATGTAGAAAGT
GCCATATAAATCGAAATATAATATTTTAATACACATCTAT
GTTTTGTTTCTATTTCTATAATTATAATAATGATAATATA
GATGGGTTTTACATTTACATGACATGTCCAGATGTGTTAC
ATATACACATTCATATGAGATAGACAAAATCTAAAATTGA
GATTTAAGGTTACCCCAATTAAAAATAGTTTTCAAATGTT
TTTACTTCACATGACAGTATATTT

zgc:174895 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:174895-201 (1)    Ensembl 1850
zgc:174895-202 984
zgc:174895-203 (1)    Ensembl 915
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:174895-202 Contained in:
[BAC] DKEY-81N5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000057110 (1),  Ensembl_Trans:ENSDART00000155708 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH448922 (1) 1011 nt
CITATIONS (2)