Transcript

glg1a-202

ID
ZDB-TSCRIPT-131113-4242
Name
glg1a-202
Previous Names
  • glg1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056826 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056826|OTTDARG00000039611|ZDB-GENE-030131-6448 glg1a|OTTDARP00000044580 glg1a-001 LG_ CU207301.28 Danio rerio protein_coding NOVEL, 3968 bp
GTAGTAGGATTCGTAATCTCGCCGAGCGAAGATGGCGGCG
TGTGGACGTGTGCAGCGCCTGCTGCTGTTGATCCTCTTCT
CCTGCTGGATCTCTTCCTCTCGCGGACTCAAATCGGTGAT
CGTGGGCACCGAAAATGCGGCGGAGAACGCCGAGCGGGCC
AAGAACGCGGCGGCGCTGGACGGGGCGTCGGTGCGGCGCA
GCGGCGGCTGGAAGCTAGCAGAGGAGGCGGCCTGTCGGGA
AGACGTGAGCCGGATCTGCCCCAAACACTCCTGGAACAAC
AACCTGGCCGTGCTCGAGTGCCTGCAGGACCGCAAAGATG
AGACTGAAATCGCTGCCGACTGCAATCATCTGCTCTGGAA
CTACAAGCTGAACCTGACGCAGGACCCTAAGTTTGAGTCT
GTGGCTGTGGAGGTCTGCAAGTCCACCATCAGCGGGATTA
AGGAGTGTGCCGCTGAGGAGCGTGGGAAGGGTTATCTGGT
GTCCTGTCTGGTGGACCACCGCTCCAACATCTCGGAGTAC
CAGTGTAACCAGTACATCACCAAGATGACCAGCATCATCT
ACAGCGACTACCGGCTGATCTGCGGCTTCATGGACAAATG
CAGAGACGACATCAACAAGCTGTTCTGCGGGAGCGTCAAC
ACTGGGGAGAAGGACCTGCACTCTCAGGGCGAGGTGATTG
CGTGTCTGGAGAAGGCTCTGGTGGCAGAGCAGGATCAGGA
TCCGGATCAGGGGCTGGCGGGCCGCTTCTCCATCCAGGAC
TCCTGCAGGAAGGCCATCATGCGTGTGGCGGAGCTCTCCT
CTGATGACTTCCACCTGGACCGACATCTCTTCTTCTCCTG
CAGAGACGACCGAGAGCGCTTCTGTGAACACATTCCAGCT
GGAGAAGGGAAAGTCTACAAGTGTCTCTTCAACCACAAGT
TTGAGGAGGGCATGTCTGATAAGTGTAAGGATGCTCTCTC
CACCAGACAGAAGCTGATCGTGCAGGACTATAAGGTCAGC
TACTCTCTGGCTAAAGCCTGTAAGCCGGACCTGCGTAAAT
ACCGCTGCAACATGGACACGGCGATGCCCCGCGCTCGAGA
AGCCAAACTCTCATACCTGCTGCTGTGTCTGGAGGCGGTC
GTGCACCGCGGCCAGACGGTGAGCGGCGAGTGTCAGGGAG
AGATGCTGGACTACCGGCGGATGCTGATGGAGGATTATTC
TCTGAGTCCTGAGATCGTCCTGCACTGCAGAGGAGAGATC
GACACACACTGCTCCGGCCTGCACCACAAGGGCAGAACAC
TGCACTGCCTCATGAGGGTGTCCCGCGAGAAGGGCATCCT
GGAGGGACACTGCCAGAAGGCGCTCCAGACACTGATCCAG
GAGACGGACCCCGGGGCTGATTACCGCATCGACCGAGCTC
TGAACGAAGCCTGCGAGTCTGTCATCCAGACTGCATGCAA
ACACATCCGCAATGGAGACCCGATGATCCTGTCGTGTCTG
ATGGAGCACCTCTACACTGATAAGATGGTGGAGGACTGTG
AGCAGCGGCTGCTGGAACTGCAGTATTTCATCTCCAGAGA
CTGGAAACTGGACCCCATCATGTACAAGAAGTGCCAGAAC
GACGCGGCCCGCATCTGCCACACTCACGGCTGGAACGAGA
CCAGCGAGTTTCTGCCACCTGGAGCTGTGTTCTCCTGTCT
GTACCGGCACGCGTACCGCACTGAAATGCAGGGCCGGCGG
GCTTCATCAGAGTCTTCTGAAAAGGGTTCTGGAGTGAGAT
TGTCGCGGGACTGTAAGACGGAGGTGCAGCGGATCCTCCA
TCAGAGAGCTCTGGATGTGAAACTGGACCCGGAGCTCCAG
CAGCGCTGCATGACTGATCTGGGGAAATGGTGCAGCGAGA
AGACCGAGGCTGGACAGGAGCTGGAGTGTCTGCAGGATCA
TCTGGAGGATCTGGCGCCCGGCTGCAGGGATGTGGTGGGG
AACCTGACAGAGCTCGAGTCTGAGGACATTCAGATCGAAG
CACTGCTGATTCGGGCCTGTGAGCCGGTGATCCAGTCCTA
CTGCCATGAAGTGGCTGATAATCAGATCGACACCGGAGAC
CTGATGGAGTGCCTCGTGGCCAACAAACACCAGAAGGAGA
TGAACGAGAAGTGTGCTGTGGGGGTCACACACTTCCAGCT
GATCCAGATGAAGGACTTCCGCTTCTCCTACAAGTTTAAG
ATGGCGTGTAAAGAAGACGTGCTGAAGCTCTGCCCCAACA
TCAAGAAGAAGGTGGATGTGGTCATCTGTCTGAGCACTAC
AGTCAGGAATGACACCCTGCAGGAGGCCAAAGAGCAGCGA
GTGTCCATGAAGTGCCGCAAGCAGCTGCGGGTGGAGGAGC
TGGAGATGTCAGAGGACATCCGTCTGGAGCCTGAGCTGTA
TGAGAGCTGCCGGCAGGACATCAAGCAGCACTGCCAGAAT
GTGGTGTTCGGGAACGCACAGGTGATCGAGTGCCTGAAGG
AGAATAAGAAGCACCTGACGCAGCACTGCCATCAGAAGGT
GTTCCGGCTGCAGGAGACGGAGATGATGGACCCCGAGCTG
GACTTCCAGCTGATGAGGGTCTGCAAGCAGATGATCCGGC
GCTTCTGCAGCGACACGGACGCCAAGAACCTGCTGCAGTG
CCTGAAGCAGAACAAGAACAGCGAGCTCATGGACCCCAAG
TGCAAACAGATGATCACCAAGAGGCAGATCACACAGAACA
CGGATTACCGCCTGAACCCAGTGTTGAGGAAGGCCTGTAA
AGCCGACATCCCCAAATTCTGCCAGAACATCCTGAACAAC
GCCAGAGACGACAACGAGCTGGAGGGACAGGTCATCTCCT
GCCTCAAACTCAAATACGCTGACCAGATCCCGCGTCTGTG
TGCAGAGGAGGTGGCTGCGCAGGAGCAGACGGGGCAGGTG
GAGGAGTGTCTGAAGGTCAACCTGCTGAAGATCAACCATG
AGGGCTGCAAGAAGGAGGTGCTGAACATCCTGAAGGAGAG
TAAAGCCGACATCTTCGTGGACCCCGTCCTGCACACCGCC
TGCGCCCTCGACATCAAACACCAGTGTGCTGCCATCCCAC
CCGGCAAAGGCAGACAGATGTCCTGTCTAATGGAGGCTCT
TCAGGACAAACGTGTCCGCCTGCAGCCCGAGTGCAAGAAG
AGACTACAGGACCGCATAGACATGTGGAGCTACGCTGCCA
AGGTGGCTCCAGCAGAAGGTTTCTCAGATCTGGCGGGTCA
GGTGTTCACGTCTCCTGCTAAGAGCTACATCCTGAGCATG
CTGGCGATGTGTGTGGTGCTGCTGTTCCTCATGGGTCTGC
TGTGCGGACGCATCACCAAACGCGTCACGCAGGAGCTGAA
GGACAGAAGACTTGCTCAGCCACCTTTAGGAAAGGACAGG
AAAGGATACATCCCAATTAACTAACAAAAAGGAAAACCGT
CCTTCATCCGCACTGACGGAGGTCTTTAACTAACGCGTAT
TAACGATGCTAACTGCTGTTCATTAAGATGAATCTGTTCA
TCCGCAGGACTTCAGGTGTCAGTAATAATCATGAGCATCT
GCATTTCTGGATATAACAGGAGAGTTTCTGATTAAAAATT
GAAAATCTTTGCTTTTTTTTTAGTCTTTAAATGCAGAAAT
GTCCATCAAAATTAGGCTAAAATGATCCAATCTTCAGTCA
GATGCTCAAAACATCAACATTAATAGCTGAAATATGACCA
AATCCAGAGTTTTCCCATATTATGATTCATTTAAAAGGCC
ATGACTCTCGAGAGCATGCGGCCGGGAGGGATTTCATCAG
TTCCTAATGATGTAATGATGATGATAATGCTGTGTAATGG
GGTTCTGGGGGTCAGTGTGTCCATGATTGATTGCTGCAGT
CTTTTTCTTTCTCTGTGCTTTTGCATTATTTTTGTAAACA
TTATTTTAGCACTGGAAAGTGTGTGTGTGTGTGTGTGTGT
GTGTGTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations