Transcript

glg1a-204

ID
ZDB-TSCRIPT-131113-2648
Name
glg1a-204
Previous Names
  • glg1a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056828 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056828|OTTDARG00000039611|ZDB-GENE-030131-6448 glg1a|OTTDARP00000044581 glg1a-002 LG_ CU207301.28 Danio rerio protein_coding NOVEL, 1038 bp
CTGCCAGAATGTGGTGTTCGGGAACGCACAGGTGATCGAG
TGCCTGAAGGAGAATAAGAAGCACCTGACGCAGCACTGCC
ATCAGAAGGTGTTCCGGCTGCAGGAGACGGAGATGATGGA
CCCCGAGCTGGACTTCCAGCTGATGAGGGTCTGCAAGCAG
ATGATCCGGCGCTTCTGCAGCGACACGGACGCCAAGAACC
TGCTGCAGTGCCTGAAGCAGAACAAGAACAGCGAGCTCAT
GGACCCCAAGTGCAAACAGATGATCACCAAGAGGCAGATC
ACACAGAACACGGATTACCGCCTGAACCCAGTGTTGAGGA
AGGCCTGTAAAGCCGACATCCCCAAATTCTGCCAGAACAT
CCTGAACAACGCCAGAGACGACAACGAGCTGGAGGGACAG
GTCATCTCCTGCCTCAAACTCAAATACGCTGACCAGCGTC
TCTCCTCAGACTGTGAGGCTCAGATCAGTGTGATCCTCCA
GGAATCTGCTCTGGACTATCGGCTCGACCCGCAGCTGCAG
CTCCAATGCAGTGAAGAGATCCCGCGTCTGTGTGCAGAGG
AGGTGGCTGCGCAGGAGCAGACGGGGCAGGTGGAGGAGTG
TCTGAAGGTCAACCTGCTGAAGATCAACCATGAGGGCTGC
AAGAAGGAGGTGCTGAACATCCTGAAGGAGAGTAAAGCCG
ACATCTTCGTGGACCCCGTCCTGCACACCGCCTGCGCCCT
CGACATCAAACACCAGTGTGCTGCCATCCCACCCGGCAAA
GGCAGACAGATGTCCTGTCTAATGGAGGCTCTTCAGGACA
AACGTGTCCGCCTGCAGCCCGAGTGCAAGAAGAGACTACA
GGACCGCATAGACATGTGGAGCTACGCTGCCAAGGTGGCT
CCAGCAGAAGGTTTCTCAGATCTGGCGGGTCAGGTGTTCA
CGTCTCCTGCTAAGAGCTACATCCTGAGCATGCTGGCGAT
GTGTGTGGTGCTGCTGTTCCTCATGGGTCTGCTGTGCGGA
CGCATCACCAAACGCGTCACGCAGGAGCTGAAGGACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations