Transcript

glg1a-003

ID
ZDB-TSCRIPT-131113-1051
Name
glg1a-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056827 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056827|OTTDARG00000039611|ZDB-GENE-030131-6448 glg1a|no_translation glg1a-003 LG_ CU207301.28 Danio rerio protein_coding NOVEL, 896 bp
GCTCGACCCGCAGCTGCAGCTCCAATGCAGTGAAGAGATC
CCGCGTCTGTGTGCAGAGGAGGTGGCTGCGCAGGAGCAGA
CGGGGCAGGTGGAGGAGTGTCTGAAGGTCAACCTGCTGAA
GATCAACCATGAGGGCTGCAAGAAGGAGGTGCTGAACATC
CTGAAGGAGAGTAAAGCCGACATCTTCGTGGACCCCGTCC
TGCACACCGCCTGCGCCCTCGACATCAAACACCAGTGTGC
TGCCATCCCACCCGGCAAAGGCAGACAGATGTCCTGTCTA
ATGGAGGCTCTTCAGGACAAACGTGTCCGCCTGCAGCCCG
AGTGCAAGAAGAGACTACAGGACCGCATAGACATGTGGAG
CTACGCTGCCAAGGTGGCTCCAGCAGAAGGTTTCTCAGAT
CTGGCGGGTCAGGTGTTCACGTCTCCTGCTAAGAGCTACA
TCCTGAGCATGCTGGCGATGTGTGTGGTGCTGCTGTTCCT
CATGGGTCTGCTGTGCGGACGCATCACCAAACGCGTCACG
CAGGAGCTGAAGGACAGGTAGAGCGGAGAGTGGCGCGGGG
GCGGCGTGTTAGTGTGTGTGTGTGTGCGTGAGTGCGTATG
CGTGAGTGAGTGGTGCCCCCTGCAGGCCAGAATGCCACCC
TCTGCCTGGAACTCTGGGGTGGCAGGGGGGTGGCAGCAAT
GATAGACTCAAGCTCTCTAACGAGTGTGTGTGTGTGTGAG
AGATGAGTGTGTGTGCAGCATGGATGGCCACATTGGGACC
CAGTTTTAATGGCTACACACACACTCTGTTCCCCCTGACT
GTGCTCGTCCATCATCGTCTTCTGCTTCTGCTGTGGATCA
ACCGATAACACAAAGACTTCGCTCTCCGGCTAAACCCGTT
TATTTATTGTGGACGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations