ZFIN ID: ZDB-TSCRIPT-131113-4197
Transcript Name: sema7a-202
Previous Name: sema7a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056630 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056630|OTTDARG00000039448|ZDB-GENE-030131-3633 sema7a|OTTDARP00000044414 sema7a-002 LG_none CR391977.5,CR376804.6 Danio rerio protein_coding KNOWN, 1365 bp
GTCGTGACCTGACCACCAGTAATACTCTCGCTCTCTACTA
CCATGATTCGACATTATTCTTCTCTCAAATTCAAAGGGAA
TTTGGCGTATCCTTGGCTTATTTATGGAGCGTGTTTTCAA
TGCGTGTTTTGCTCTTGTAATCCCAGATTAACTCTGAAAC
AAGATAATGCTCCATTGAATTACAACACCAACTACAGTCA
TACAGTTTTGTTCCATGAAGAAGGATCGAAAAGTTTATTT
GTGGGAGGATCAAACATTGTTCTGCACTTTGATGTAGACA
GTTACGAGATTTTGGAGAATTTTACTCTAAATGCAAACTT
GCCAAGATGTGGTGAGAGCTCTTGTGAAAATGTAGTCACA
GTAATTGAGACTTTTCAAAACTGCAAATTTGTATGTGGGA
CAAATGGAGAAGAGCCACAGTGCTGGGAACTGTATCCAAG
AGAAAGCAATCATTCTGTTGTTAAGTCTGTAGAAGGCACA
GGGATCTCGCCACATTCTAGTGAACAAAACTCCTTGTCTC
TTGTAGCAGATGGAGATCTATATGCAGCAGCTCCTCTATA
CAGTGATGGAACACTTCTGCAGTTCCGTAGAAAAGCTGGA
AAGCGAATCAACGTATGGATGCATGATCAGTGGGTCTCAG
AACCTACTTTTATCTCCAGTTTCCTGGCCAAGCGCAAAAA
TGACTCCTTGAATGAGAAGATATATGTCCTATTCCGAGAA
AAAAACTCAGACACTAGTCCAGAGGCGGATCCTTGGATAT
CTAGAGTTGCCAGAGTGTGTAAGATTGATGAGGGCGGTTC
CAAACAGTTCCTCCAAAACATATGGACCTCTTTCCTGAAG
GCACGACTTGTTTGTGGGATACCAAAGGAGTCACTGTATT
TTAACCGCCTGCAAGATGTTTTTGTCCAGCATGCTGAGGA
CTGGAGGGATTCACTAGTTTATGCACTCTTCTCCAGTAGC
TGGAACTCTACCGCTGTCTGCATTTACTCTTTAGCAGATC
TTGATGACATATTTGAGAAATCAAACTATAAAGGTTTTTC
TGAGGCCATTCCCAACCCAAGACCAGGAAAATGTGTGGAA
AACAGCAATTCCCTTCCAATTCCTACTCTCAAAATTATTA
AAGACTATCCAGAGATGAAGGACTGGATACATCCCATTCA
AAAAGACACACCTTTCTTCACAAGTAGCAAGAATTTTACC
AAGATAGTTGTTGATCAAATTCGAGCTTTGGATGAAAATG
TATACAATGTGCTGCTGCTTGCGACAGGTACACATAGATG
GTATATGGGTTCAGTCTTTCTGTTCATTGATGTTTGCTTT
GTGACTTTCTCCACATAGAAAATAACAATACCCTTAACAT
TCCAA

sema7a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sema7a-201 (1)    Ensembl 3134
sema7a-202 1365
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sema7a-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056630 (1),  Ensembl_Trans:ENSDART00000156179 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC155290 (1) 1440 nt
GenBank:EH435183 (1) 973 nt
CITATIONS (2)