ZFIN ID: ZDB-TSCRIPT-131113-2601
Transcript Name: sema7a-201
Previous Name: sema7a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056629 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056629|OTTDARG00000039448|ZDB-GENE-030131-3633 sema7a|OTTDARP00000044413 sema7a-001 LG_none CR391977.5,CR376804.6 Danio rerio protein_coding KNOWN, 3134 bp
TAATAGCCTGAAACAAGATTACAATAAAACGCAACGCATT
GAACACACGCATCTTTAATCTACCGCGCAACACCAAGTAG
ACGCGCATTATAATTTGAAGCTCGCCCGGAACCGCAGATG
TCGTGACCTGACCACCAGTAATACTCTCGCTCTCTACTAC
CATGATTCGACATTATTCTTCTCTCAAATTCAAAGGGAAT
TTGGCGTATCCTTGGCTTATTTATGGAGCGTGTTTTCAAT
GCGTGTTTTGCTCTTGTAATCCCAGATTAACTCTGAAACA
AGATAATGCTCCATTGAATTACAACACCAACTACAGTCAT
ACAGTTTTGTTCCATGAAGAAGGATCGAAAAGTTTATTTG
TGGGAGGATCAAACATTGTTCTGCACTTTGATGTAGACAG
TTACGAGATTTTGGAGAATTTTACTCTAAATGCAAACTTG
CCAAGATGTGGTGAGAGCTCTTGTGAAAATGTAGTCACAG
TAATTGAGACTTTTCAAAACTGCAAATTTGTATGTGGGAC
AAATGGAGAAGAGCCACAGTGCTGGGAACTGTATCCAAGA
GAAAGCAATCATTCTGTTGTTAAGTCTGTAGAAGGCACAG
GGATCTCGCCACATTCTAGTGAACAAAACTCCTTGTCTCT
TGTAGCAGATGGAGATCTATATGCAGCAGCTCCTCTATAC
AGTGATGGAACACTTCTGCAGTTCCGTAGAAAAGCTGGAA
AGCGAATCAACGTATGGATGCATGATCAGTGGGTCTCAGA
ACCTACTTTTATCTCCAGTTTCCTGGCCAAGCGCAAAAAT
GACTCCTTGAATGAGAAGATATATGTCCTATTCCGAGAAA
AAAACTCAGACACTAGTCCAGAGGCGGATCCTTGGATATC
TAGAGTTGCCAGAGTGTGTAAGATTGATGAGGGCGGTTCC
AAACAGTTCCTCCAAAACATATGGACCTCTTTCCTGAAGG
CACGACTTGTTTGTGGGATACCAAAGGAGTCACTGTATTT
TAACCGCCTGCAAGATGTTTTTGTCCAGCATGCTGAGGAC
TGGAGGGATTCACTAGTTTATGCACTCTTCTCCAGTAGCT
GGAACTCTACCGCTGTCTGCATTTACTCTTTAGCAGATCT
TGATGACATATTTGAGAAATCAAACTATAAAGGTTTTTCT
GAGGCCATTCCCAACCCAAGACCAGGAAAATGTGTGGAAA
ACAGCAATTCCCTTCCAATTCCTACTCTCAAAATTATTAA
AGACTATCCAGAGATGAAGGACTGGATACATCCCATTCAA
AAAGACACACCTTTCTTCACAAGTAGCAAGAATTTTACCA
AGATAGTTGTTGATCAAATTCGAGCTTTGGATGAAAATGT
ATACAATGTGCTGCTGCTTGCGACAGACGATGGGATGATC
TTCAAAATCCTACAGCATGGCTCTAAACCTTTCATCATTT
CTGAAACGCATTTGTGCAATGGCTGTGCACCCATTCAATC
AATGAAACTTGACTCTAAAAAGCGGAAGCTCTTTGTTGGA
TATCCTGGTCAAATGTCGGTGTTAGAACTACAGAGATGCC
AAGACTATGGTGCTTCTTGTGAAGAATGCGTTCTTTCTCG
TGATCCATACTGCGCATGGTCTGAAAAAGGCTGCACGTCA
CAAACTAGAGGAGGAATACAAAACATTTCTGATGGCAATG
TCACTAAAGTATGTGACCACAAATCAGTGGGAAGAGTTAG
ACGAGACGCTCAACAGTCATCTACTGCTCCCTCAAGGATT
CAACACACTGTGGCCACTGATGTCCCCTTCTACTTATCTT
GTCCGGTCGATTCACATCATGCCAGTTATAGATGGGAACA
CGGGGGCAAAAGCAACCCATGTCAACAGACCCAATCGGAA
TACCTCCTCCTAATCCCAGCTATGACGGCTGAGAATTATG
GCAATTACAGTTGTGTTTCCCAGGAACGTGATTACATCAA
AGTTGTGAGAGAATATGAACTCCTTGCTAAGTCTGTTTTT
AATGATGCTTTCAAGCTGAAAATACAAGACCGGCAGCTAA
TGGTAGCATTTGTCACGAGTGCCTTCTATCTGTGCTCACT
TTAAGGTCAAGCTTGTTATGTAAGTGCTTCTGTCTTTAGG
CATTTCTGACGACATTTAAGCTGATTAAAACATCAGTCAC
GTTGTCAAGAGGCTAGTGGTTCGTGGGCAAAGATAATTGT
CTTACAAAGTCAGCACTGAAGTGCACATCCTAGAAGATAA
CTTCCCATTATATGTTAACCATCTATTTAGTATGTGCTGA
ATTGGTACAGTGGAGTACCAAAGTCTAAAACTCTTTGGAA
TCTGAAAATACAGTATTTAGCATTGACAGCGTTTTTTACA
TGCTGCACAGATATTATGTTTGGAGATTCCCTGTAAATAT
TACTAACAATTAGAATAGTAATACATTTAATTGGTAATGT
GTTTTTTTTATAACAGCAAAAAAAAAAAAAAATAATAATA
ATAATAATTTTTAAAAAATCAAGTAAAAACAACCCTGAAA
TAAAATGCTTTGTGACAAGATGTAAAAAATTGCAGGGAGA
GAATTACACTGTTTTACAAAGAAAATTTCATATATAAACA
TCAAAAAGCACTTTAAGACTGACCCTCAACATTGATCTTT
ACCAATACAAAAAAAAAAAAAAAAAAGCCACTGGACTAAA
TTTGAATAAAATATGAACTGCTTATTATCACCCCTCCCCT
CCTACATGAACTTAAATTAAATTCAAGAAATTATTAAATA
AATATCTGCTCGATAGTCACTTGGATTTTTAAAAAAGTTT
TGGTTCAAATAAAGGCAGAGAGGTTTTCAGGAGTGTGGTT
AACCTGAAGCAAGTTTTTATTTTTTGTCTATATATTTAGT
GTTTGCGTGAAGGTCTTTAAGATTCAGTTTATTATTTATG
AAGAAAAGGTTATTGTTCTACATTATGGCTGTGATGAAGA
TAGGGATTTTGTGTTGATTGCCCGTTTGAAAACTGCACCT
TGACCCTTATGAGGAATGAGGAAGAAAGAAATTGAAGAAA
GAATTCCACAGCCTTTCACACTAGCAAAATGTATGGCCAT
AACCATATCACCCTGCAGCCCAAGACCAGTTCCACACTAA
AGCTAAGCAGGGCT

sema7a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sema7a-201 3134
sema7a-202 (1)    Ensembl 1365
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sema7a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056629 (1),  Ensembl_Trans:ENSDART00000127274 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH461184 (1) 882 nt
GenBank:EV854444 (1) 760 nt
CITATIONS (2)