ZFIN ID: ZDB-TSCRIPT-131113-4195
Transcript Name: si:dkeyp-73b11.9-003
Previous Name: dkeyp-73b11.9-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056624 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056624|OTTDARG00000039445|ZDB-GENE-131119-17 si:dkeyp-73b11.9|no_translation DKEYP-73B11.9-003 LG_ CR391977.5 Danio rerio processed_transcript NOVEL, 866 bp
AACGCAGTTTAAAGTTACTGAGCAACGTTATAAAACAATA
TCTTTTTTTTATATACGCTGTATAATTAGTGTTATTATTA
CAAAGTGAACTGCTGTCGTTTCACTGTTGTTGTTGTTTTT
GCTTTTAGAGATGTCACTTACTCCAGAGACGCACTCACTT
GCACAGCATTGAATGGAAAAGGCTTTGTCCATGTCCAGTT
GAGGGGCATCAAGAACACGCAGATGGCCTAAACCTGTGTC
AGCCTGGACAGACTGCAGTTCTGCTACTCCACGCCAAGGC
TTTTGTATGGATGTCTGACTACTGTGTTCTCTAAAGGTTT
TCTGGAAGCTCCAGTTGAGGGCATCAAGGACAAACTGATG
GCCTAAACAAGTGTCAGCCTAGACAGACATCTATTGCAGT
TCTGCTACACAAGACCAAACTCTCTGCTTTTGTATGGATG
TCTGACTAGTCCGATGTTCTTTGAAGGTATTACTGGAGCA
AAACGACAGCACTTGTTACAGTGAAATTTGTGTTAATTAA
AGATAGTGATATATGTGTAACAGGTCCAGTACATTTGTCA
TAAAGGTTAAATCACAGTAAGTACTGTAAAAATAACTTGT
TTGCCTTTGCCACAACAGGTCATGGTGTGTGCTTACTGCT
TGTAGTAAACGCACGCGCTGATCTGATGCGGGAGAGATAT
ACGCAAACACATTTGTATTTACTGTTTTGTTTTGCCTCAA
TAAAGTGTTGTTGGAGCTTGGTATGTTCACAGTTGAAATC
ACTGAAGTCACATGGAACGTTTTGACAATGTGTTTTGTGC
CTTATCTGGACTATGATCATCTTGGGACCATTGCTGTCTG
TAGAGGATGAGGAGCATTTAATTAAA

si:dkeyp-73b11.9 TRANSCRIPTS
Type Name Length (nt) Analysis
lincRNA si:dkeyp-73b11.9-001 (1)    Ensembl 1579
si:dkeyp-73b11.9-004 (1)    Ensembl 406
ncRNA si:dkeyp-73b11.9-002 (1)    Ensembl 548
si:dkeyp-73b11.9-003 866
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-73b11.9-003 Contained in:
[BAC] DKEYP-73B11 (1)

Genome Resources: Vega_Trans:OTTDART00000056624 (1),  Ensembl_Trans:ENSDART00000156487 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH579605 (1) 884 nt
CITATIONS (2)