ZFIN ID: ZDB-TSCRIPT-131113-2600
Transcript Name: si:dkeyp-73b11.9-004
Previous Name: dkeyp-73b11.9-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: lincRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056626 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056626|OTTDARG00000039445|ZDB-GENE-131119-17 si:dkeyp-73b11.9|no_translation DKEYP-73B11.9-004 LG_ CR391977.5 Danio rerio processed_transcript NOVEL, 406 bp
ACGCACTCACTTGCACAGCATTGAATGGAAAAGGCTTTGT
CCATGTCCAGTTGAGGGGCATCAAGAACACGCAGATGGCC
TAAACCTGTGTCAGCCTGGACAGACTGCAGTTCTGCTACT
CCACGCCAAGGCTTTTGTATGGATGTCTGACTACTGTGTT
CTCTAAAGGTATTACTGGAGCAAAACGACAGCACTTGTTA
CAGTGAAATTTGTGTTAATTAAAGATAGTGATATATGTGT
AACAGGTCCAGTACATTTGTCATAAAGGTTAAATCACAGT
AAGTACTGTAAAAATAACTTGTTTGCCTTTGCCACAACAG
GTCATGGTGTGTGCTTACTGCTTGTAGTAAACGCACGCGC
TGATCTGATGCGGGAGAGATATACGCAAACACATTTGTAT
TTACTG

si:dkeyp-73b11.9 TRANSCRIPTS
Type Name Length (nt) Analysis
lincRNA si:dkeyp-73b11.9-001 (1)    Ensembl 1579
si:dkeyp-73b11.9-004 406
ncRNA si:dkeyp-73b11.9-002 (1)    Ensembl 548
si:dkeyp-73b11.9-003 (1)    Ensembl 866
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-73b11.9-004 Contained in:
[BAC] DKEYP-73B11 (1)

Genome Resources: Vega_Trans:OTTDART00000056626 (1),  Ensembl_Trans:ENSDART00000154982 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CB891033 (1) 408 nt
CITATIONS (2)