Transcript

si:dkeyp-73b11.9-002

ID
ZDB-TSCRIPT-131113-1002
Name
si:dkeyp-73b11.9-002
Previous Names
  • dkeyp-73b11.9-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000056625 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056625|OTTDARG00000039445|ZDB-GENE-131119-17 si:dkeyp-73b11.9|no_translation DKEYP-73B11.9-002 LG_ CR391977.5 Danio rerio processed_transcript NOVEL, 548 bp
ATAATTAGTGTTATTATTACAAAGTGAACTGCTGTCGTTT
CACTGTTGTTGTTGTTTTTGCTTTTAGAGATGTCACTTAC
TCCAGAGACGCACTCACTTGCACAGCATTGAATGGAAAAG
GCTTTGTCCATGTCCAGTTGAGGGGCATCAAGAACACGCA
GATGGCCTAAACCTGTGTCAGCCTGGACAGACTGCAGTTC
TGCTACTCCACGCCAAGGCTTTTGTATGGATGTCTGACTA
CTGTGTTCTCTAAAGGTATTATGGAGCAAAACAACAGCAC
CTGTTACAGTGAAATTTGTATTCATAAAAATAGTGATACA
TGTGTAGCAGGTCCAGAACATGTGATGTCATTGAGAAGTT
GTTTTTATTAAATGTCATTAAAACAAATAAATAAACATGC
TATTTAAATAAATCTAAATATTAAAAACTTGAGGATTAAG
ATGACAAATGAAATGCATCATCTGTCTTGCGAAAAGGGTC
TAAGAATATTGGTGTTTTCCAACTGAAAGGGATAGTTCTC
CCAAGAATGAAAATTTACTCACATTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations