ZFIN ID: ZDB-TSCRIPT-131113-3832
Transcript Name: mcm8-202
Previous Names: mcm8-002, ch1073-376h13.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055171 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055171|OTTDARG00000038505|ZDB-GENE-120927-1 mcm8|OTTDARP00000043270 CH1073-376H13.1-002 LG_none FP017149.4,CU929122.5 Danio rerio protein_coding NOVEL, 700 bp
CGGACAGCACACCCATCACCACCCGCCAGCTCGAGTCCCT
CATCAGACTCACTGAGGCAAGAGCCCGTGTTGAGCTCAGG
GAAAAAGCTACACAAAGTGATGCAGAGGATGTTGTGGAGA
TCATGAAACACAGCTTGACAGACACGTACTCTGATGAATT
TGGCCGTCTGGATTTTGACCGCTCTCAGCTCGGCTCCGGG
ATGAGTAACCGCTCCAAAGTCAAGAAATTTGTCTCAGCTT
TAAACAAACTCGCTGAGCGAACCAGCAAAAGCATGTTTGA
ACTCCAAGATCTGCGGCAGCTCGCCAAAGATCTGCAGATA
CAGTCTCTCCAAATCTCTTTTTTTCCACTTGTGTTTGGTC
AGGTTGTGGATTTCGAGGGTTTCATCTGTGCGCTCAATGA
GCAGGGTTACCTTCTGAAGAAAGGCCACAGGATGTATCAG
CTTCAGACCATATGAGTTATGGTGTTACACTGTTATTGTC
TCTGTTTTAATGCAACAAATATTATATTTATATTACAGCA
TGTAATATGTTTCAGTATTTACAATGTTGAGAACTGTACA
TTGATTTAATGTACATAAATACACCGGTTAATTATTATGC
ACCTGTAAATAGTTTGTACAGTAGCAAATCATAGCCACAT
TTATGAACATTAAAGCAACATTTTTAGATTGTTTTGAATT
ATATGGATTGATGTTACTCA

mcm8 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mcm8-201 (1)    Ensembl 2915
mcm8-202 700
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mcm8-202 Contained in:
[Fosmid] CH1073-256P11 (1), CH1073-376H13 (1)

Genome Resources: Vega_Trans:OTTDART00000055171 (1),  Ensembl_Trans:ENSDART00000156803 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EX464516 (1) 700 nt
CITATIONS (2)