Transcript

mcm8-201

ID
ZDB-TSCRIPT-131113-2237
Name
mcm8-201
Previous Names
  • mcm8-001
  • ch1073-376h13.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055170 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055170|OTTDARG00000038505|ZDB-GENE-120927-1 mcm8|OTTDARP00000043269 CH1073-376H13.1-001 LG_none FP017149.4,CU929122.5 Danio rerio protein_coding NOVEL, 2915 bp
GTGATATCAGTTGGCGCCAAACTCGAAGCCTCGCTAGACG
TCACTAACTGAGGAAGTAAACAAGCTGGCTGCTCTTTTAG
CAACAACAGACTTATCGAGAAGGTTAAAAAAATGAGCAGT
CAGGGTTCAAGCCGAGGATCATGGAGAGGTGGAAACAGCT
CAGGATCTGGAGGATGGAGAGGTGGAGGAGGGTGGAGAGG
AGGAAGAGGATGGAGTAATGGTCAGTATAGAGGCTGGAGA
GGCCGTCAGTGGAGTGGAGGAGGAGGAGGAGGAAGAGGAA
ACTATTCAAACAACAATACACAAAAGGGAAATGCTCCACA
AGTTAGTCAGGCACGTGTGACTCAAGCAACCCTTGACATC
ACTTGTCCATATAAAGGATGGCGACTCTACTTTTCTGAAG
GTTTTGTTGAAAGTTCACCTTATGTTGAGAAAATAAAGGT
GTTTGAGCAGTACTTCACATCACAGATCGATCTTTATGAT
AAGGATGAGATTGAAAGGAAAGGCAGCATTCTGGTGGACT
ACAAAGACCTTCTGTCCAACAAACAGGTTTCACACTCCCT
ACCGGATCTGGCCAGAGATCTTAAGGAAATGCCAGAGAAA
ATTCTAGACTGCTTGGGTGTAGCAATTCATCAGGTGTTGA
CACTGGATCTAGAGAGACATGCAGCAGAACTGCAGGGGCA
GGAGGAGCTTCCAGCAGGAATAAGGCCCATAATCAACATC
CCTCACATCAGTGCTAGGTTGTACAACTATGAGCCACTGA
CTCCTTTAAAAAGTCTGAGAGCAAATTTATACGGCAAGTT
TGTTGTGATCAGAGGTACTGTGGTGAGAGTGAGTAACATT
AAACCGCTCTGCATGAAGCTGGCATTCGTCTGTAACAGCT
GTGGAGACACGCAGAGCGTCACACTGCCTGATGGGAAATA
CACCATGCCCACGAAGTGTTTACAGTCTGAATGTCGTGGT
CGGTCATTCACTCCAAACCGAAGTTCACCTTTCACACTCA
CTGTCGACTGGCAGACAATAAAGGTTCAGGAGCTGATGTC
TGGTGACCAGCGTGAGTCTGGCCGAATCCCGCGCACCATT
GAATGTGAGCTCACGCAGGACCTGGTGGACAGTTGTGTGC
CTGGAGACATGGTCACCATCACAGGGGTCATTAAAGTGTC
CAATGAAGAGGGAAGTACCAGAAACAAGAAGGACAAGTGC
ATGTTCCTGTTGTACATTCAAGCAAATTCAGTCAGCAACT
CGAAGGGTCAGAAAAGCAAAGCCGTGTCTGAATCTGAGGG
CCAGGGACCATCGGTGGAGTTCTCCATCAAGGATCTCTAC
GCCATTCAGGAGATCCAAGCACAAGAAGACCTGTTCAAGC
TTATAGTCAACTCTCTTTGTCCAGTCATTTACGGCCATTT
GCTTGTTAAAGCTGGGTTGGCTCTGGCTCTGTTTGGAGGA
TGTCAGAAGTATGTTGATGATAAAAACCGTATCCCGATAA
GAGGAGACCCGCATATGCTCATCGTTGGAGACCCTGGACT
TGGCAAAAGTCAGATGTTACAGGCTGTGTGTAACGTGGCC
CCACGGGGTGTTTACGTATGTGGAAACACAACCACCACCT
CAGGACTGACTGTTTCTCTATCCCGGGACAGCGGATCCGG
AGACTACGCTCTTGAGGCTGGAGCATTGGTGCTGGGAGAT
CAAGGCATTTGTTGCATTGATGAGTTTGATAAGATGGGCA
GTCAGCATCAGGCTCTTCTGGAGGCCATGGAACAGCAAAG
CATCAGTCTGGCTAAAGCTGGGATTGTCTGCACGCTTCCT
GCTCGAACCTCCATCATCGCAGCAGCCAATCCAGTCGGAG
GACATTACAATAAAGGAAAGACCGTCTCCGAGAATCTGAA
AATGGGCAGTGCATTGCTGTCCAGGTTTGATCTGGTCTTC
ATCTTGTTGGACACTCCTAATGAGGACCACGATCACCTGC
TGTCTGAACATGTGATGGCGATGCGTGCAGGAAAGAGTGG
AGCAGTCAGCGGCGCTGCGGCAACACGCTTTAACACACAT
GAGTCCAGCATCTCTATTCTGGAGGTCTCATCGGAGAAAC
CCCTCGCAGACACACTCAAACTGGTTCCCGGAGAAGCTTT
TGACCCGATTCCTCACCAACTCCTCCGGAAGTACGTGGGT
TACGCCAGACACTACGTCCACCCGACTCTCTCTGCAGAGG
CTGCGCAGGTGCTGCAGGATTTCTATCTGGAGCTGCGCAA
ACAGAACCAGACGGCGGACAGCACACCCATCACCACCCGC
CAGCTCGAGTCCCTCATCAGACTCACTGAGGCAAGAGCCC
GTGTTGAGCTCAGGGAAAAAGCTACACAAAGTGATGCAGA
GGATGTTGTGGAGATCATGAAACACAGCTTGACAGACACG
TACTCTGATGAATTTGGCCGTCTGGATTTTGACCGCTCTC
AGCTCGGCTCCGGGATGAGTAACCGCTCCAAAGTCAAGAA
ATTTGTCTCAGCTTTAAACAAACTCGCTGAGCGAACCAGC
AAAAGCATGTTTGAACTCCAAGATCTGCGGCAGCTCGCCA
AAGATCTGCAGATACAGGTTGTGGATTTCGAGGGTTTCAT
CTGTGCGCTCAATGAGCAGGGTTACCTTCTGAAGAAAGGC
CACAGGATGTATCAGCTTCAGACCATATGAGTTATGGTGT
TACACTGTTATTGTCTCTGTTTTAATGCAACAAATATTAT
ATTTATATTACAGCATGTAATATGTTTCAGTATTTACAAT
GTTGAGAACTGTACATTGATTTAATGTACATAAATACACC
GGTTAATTATTATGCACCTGTAAATAGTTTGTACAGTAGC
AAATCATAGCCACATTTATGAACATTAAAGCAACATTTTT
AGATTGTTTTGAATTATATGGATTGATGTTACTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations