header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-3497
Transcript Name: spop-202
Previous Name: spop-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051817 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051817|OTTDARG00000036400|ZDB-GENE-040426-1378 spop|OTTDARP00000040717 spop-001 LG_none BX248239.12,AL929247.5,CU855817.6,BX908767.10 Danio rerio protein_coding KNOWN, 2448 bp
ATTCATTTAACCCGGACGTGAAGCAGCTCCATAGAAAAAT
ATCCCATACGGTAAAACAGCTTATCTTCCAAAAAGATCTC
TTTCTGGACACCTCGTTGTTCGATAATCGGCAAAGAAAGG
CACTCCGTAGTAACTGTAAAGCCTGAAACTTCTGACGTAG
AGAGGAAAACATTCTGCCACGAGATGCAACATCTCTGCTT
CATTTCAAATTAGTGTTAATGCTGAAGAACTGGACGGCTC
ACTGAAAAACACCTCAGGTTTCTCCCTGCTTTCCCTCCTT
GTTCTCTGGGTTACGCTGAACACGAGTGTGTGCCCGGATC
CTGGCGGCGGCTGTGAAATACACATGTGTGCGTGTGTTTG
CTTATGAGCAAGTGATTACATCTGGACACTTTCTTGGAGA
CATCCTGTGGTGGTTGGCGAAGTGACCCTCCCCTTAACCC
AAAAATCAAACGCTCAAAACTGGCGATGTCCAGGGTGCCG
AGTCCTCCCCCTCCTGCAGAAATGACCAGCGGCCCTGTGG
CCGAAAGCTGGTGTTACACACAGATCAAAGTGGTTAAGTT
CTCCTATATGTGGACCATCAACAACTTCAGCTTCTGTCGG
GAGGAGATGGGAGAGGTCATCAAAAGCTCCACCTTCTCCT
CGGGGGCCAATGACAAACTCAAATGGTGTTTACGAGTGAA
TCCTAAAGGGCTGGATGAGGAGAGTAAAGATTATCTGTCT
CTCTATCTGCTCCTGGTCAGCTGTCCTAAGAGTGAGGTTC
GAGCCAAGTTCAAGTTCTCCATCCTTAACGCCAAGGGCGA
GGAAACCAAAGCTATGGAGAGCCAACGGGCATATCGCTTC
GTGCAAGGGAAAGACTGGGGTTTCAAGAAGTTCATAAGGC
GAGACTTTCTTCTAGATGAGGCCAACGGGCTGCTGCCTGA
TGACAAGTTAACGCTCTTCTGTGAGGTGAGTGTGGTGCAG
GACTCAGTGAACATCTCTGGGCAGAACACAATGAACATGG
TGAAGGTTCCTGACTGCCGGCTGGCAGACGAGCTTGGCGG
ACTGTGGGAACATTCTAGATTCACAGACTGCTCACTGTGT
GTCGCCGGCCAGGAGTTTCAGGCACACAAGGCCATTCTGG
CAGCACGTTCTCCAGTATTCAGCGCTATGTTTGAACACGA
GATGGAGGAGAGTAAAAAGAACCGTGTTGAGATAAATGAC
GTGGAGGCTGAGGTCTTTAAAGAGATGATGTTCTTCATCT
ACACTGGCAAAGCACCCAACCTGGACAAGATGGCTGACGA
CCTGCTTGCTGCTGCTGACAAGTATGCTCTGGAGCGGCTG
AAGGTGATGTGTGAGGACGCGCTGTGCACCAGTCTGTCTG
TGGAAAACGCAGCAGAGATTTTGATCTTGGCCGACCTGCA
CAGTGCAGACCAGCTCAAGACACAGGCTGTGGACTTTATC
AACTACCATGCATCTGATGTGATGGAGACTTCGGGGTGGA
AGTCAATGGTGGCGTCTCACCCTCACCTGGTTGCCGAAGC
ATACCGTTCACTGGCCTCCGCCCAGTGCCCTTTCCTGGGT
CCTCCCCGCAAACGGCTCAAACAGTCTTAGTGGCTTCTCA
TACCGTTTCCTAACCTGCTCACTTACACACACACTTAAAC
ACAACTGCCTACAAGATGGGGGGGCGTTATTTTAGATTTA
CATCCCCCCCAAGCTCTGTCCCTTTAGATGCCTAAACCAG
CTCTTGACCTGCCCCTCCCTTCACGTTATCCAGACAGAAC
CTTTTGGCACCGAGGACCATCTTTGTGTCTGTCCTCAATT
TTGGGGAGTGTGGAGGCTGCCACAGGTCGATTCCTGTTCA
AGAAGCAAGGCCGACCTGGATCAGTCAGTTCATCTGTCCA
GTAGAGAAATGATTGTGGATTCAGAGTGGGCAGGTGGATC
AGGGTTGAGCTTTCAGGTTGGGCGGGTAAACACGAGATGG
ATTAAGACTAGACTTTATACGTAACTCCTTCCACTGGGAC
ACTGTGTGCTCTCCTTCACTGTGTGAATCAGTTCTCCATC
TCCACTTCCTCCTTACTTCATAAAAAAAGAAGAAACACAA
TCAGTTGATAGACATTCCCCTTTATGGTCATGGATGGAGG
GATCTCTCTTTTAAACGGAATGGAAGACTAACTCCTTTAT
CGTTGCGAAAGTACTTTTAAATAGGTAGCATGTGTCTTCG
TAATGACGACATCAGTAGATTCCTGTGTGACTTTATGAAT
CACGTGATGACAAACCAATTTTTTTTCCAGAACTGTCCTC
CGTTTCTTGGGAAATTGAGCCTAAAATTTGTCAACTCCAT
GAAATTTTGGCCTAAAAACAAGCCTAGCTTCCAAACGTTT
AGGTGGACTTCGGATGGTTTGGTCTTCGTTTACATGGCGA
AAAAATAAATTGACAGATTTGTTGAGTGATGTAAAAAAAA
AAAAAAAA

spop TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA spop-202 2448
ncRNA spop-002 (1) 535
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
spop-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000051817 (1),  Ensembl_Trans:ENSDART00000163473 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC152667 (1) 2419 bp
GenBank:BC053276 (1) 2254 bp
GenBank:EB921919 (1) 632 bp
CITATIONS (2)