header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-318
Transcript Name: spop-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051818 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051818|OTTDARG00000036400|ZDB-GENE-040426-1378 spop|no_translation spop-002 LG_none BX248239.12,AL929247.5,CU855817.6,BX908767.10 Danio rerio protein_coding KNOWN, 535 bp
CATTCATTTAACCCGGACGTGAAGCAGCTCCATAGAAAAA
TATCCCATACGGTAAAACAGCTTATCTTCCAAAAAGATCT
CTTTCTGGACACCTCGTTGTTCGATAATCGGCAAAGAAAG
GCACTCCGTAGTAACTGTAAAGCCTGAAACTTCTGACGTA
GAGAGGAAAACATTCTGCCACGAGATGCAACATCTCTGCT
TCATTTCAAATTAACCGATCAGATGTGCCACACAAGTGTG
AATTTTTCATATGAAGCAAAACCAGGTTATACGAGCCATT
CTGTTAATGTATGTTCGCGAATACAGACACGCGTGTTAAT
GCTGAAGAACTGGACGGCTCACTGAAAAACACCTCAGGTT
TCTCCCTGCTTTCCCTCCTTGTTCTCTGGGTTACGCTGAA
CACGAGTGTGTGCCCGGATCCTGGCGGCGGCTGTGAAATA
CACATGTGTGCGTGTGTTTGCTTATGAGCAAGTGATTACA
TCTGGACACTTTCTTGGAGACATCCTGTGGTGGTTGGCGA
AGTGACCCTCCCCTT

spop TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA spop-202 (1)    Ensembl 2448
ncRNA spop-002 535
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
spop-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000051818 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AL926916 (1) 538 bp
CITATIONS (1)