ZFIN ID: ZDB-TSCRIPT-131113-3451
Transcript Name: pecr-201
Previous Name: pecr-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050592 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050592|OTTDARG00000035547|ZDB-GENE-050417-232 pecr|OTTDARP00000039724 pecr-001 LG_ BX323548.13 Danio rerio protein_coding KNOWN, 1278 bp
GACTTTTATCTTACAATATTATACTCTGGTTGTTTCGCTG
TCGTAGTCAACATGGCAGCGTCCAGTGTTTTTAAAGCAGG
TCTTTTCAATCACAAAGTCGCAGTCGTGACGGGTGGCGGG
ACTGGCATTGGAAAAGCCATCACTTCTGAGCTCTTACAGT
TAGGATGCAGTGTGGTTATATCGTCCAGGAAGCTGGAGCG
TCTGAAGTCAGCAGCGGAAGAGCTGACACTGAAAATCCCT
TCATCCAGTCCAGCTAAAGTGACCCCTATAGAATGCAACA
TCCGCAATGAAGATGAGGTGAAGAACCTGATGGCCTCTAC
ACTAAAGCTTCACGGGAGAATCGACTTTTTGGTGAATAAT
GGAGGTGGCCAGTTTTCCAGTCCGGCAAACATGATGAGTG
CAAAAGGCTGGAAGGCTGTGATCGACACCAACCTCAATGG
AACGTTCTTATGCTGCAGAGAAGCATATAATGCCTGGATG
AAGGACCATGGAGGTGTAATCGTGAATATCATTGCTGACA
TGTGGAAAGGCTTTCCTGGAATGGCGCACACAGGAGCAGC
TCGAGCAGCGGTGGACAACCTGACCAAGAGTTTGGCCATA
GAGTGGGCTCACAGTGGGGTCCGCATAAACTCTGTGGCGC
CGGGAACAATCATCTCCAAAACTGCTATGGAAAACTACAA
AGAATATGGGCCTACTTTGTTTAAGATGTCAGTGCCATTC
AGTCCTGCTAAAAGACTCGGTGTTCCTGAGGAGATATCTC
CGGCTGTGTGTTTCCTGCTGTCTCCGGCTGCCAACTATAT
TACTGGAGCAACCCTGAAGGTGGATGCAGGACAGAGCCTT
TACCACTCCATCTGGGAAATCCCAGAACACGATGCCTGGC
CTGAAGCTCCAGAGGGAGAAAATACAGACGTGCTGAGAGA
AATCATGGACAAGACTAAATCCAAGCTGTGAATCAGAGGA
AAACAAGTCTAGACTGTCAAAACAGCTGCTCTTCATCAAT
GTGGGTGGAAGACAAATGCTTTTGCTCGGAATTGTAACAC
GTCTCGACTGTGGCCTTTGGAGTGAATCTCACTGAATATT
TTATTGCGTAATTGAGCTCTAATAGTTCATAAGGAACTGT
GTAAATATGTGTAATAATATGGTATTGTGAATTTAACAAT
TGTGATTAATATTTCCAAAAATAACTTTGATCAGCCATCA
TTGTAAGATTACAAATATGTAATGTATTTTTAAAAAATAC
ATTTTTTGTTGTGACAACTTTTAAACAAATTCATTAGT

pecr TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pecr-201 1278
ncRNA pecr-002 (1)    Ensembl 785
pecr-003 (1)    Ensembl 814
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pecr-201 Contained in:
[BAC] DKEY-31D5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000050592 (1),  Ensembl_Trans:ENSDART00000078387 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC093230 (1) 1283 nt
GenBank:EG577153 (1) 896 nt
GenBank:CO928443 (1) 888 nt
CITATIONS (2)