ZFIN ID: ZDB-TSCRIPT-131113-1855
Transcript Name: pecr-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050594 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050594|OTTDARG00000035547|ZDB-GENE-050417-232 pecr|no_translation pecr-003 LG_ BX323548.13 Danio rerio protein_coding KNOWN, 814 bp
GTAGTCAACATGGCAGCGTCCAGTGTTTTTAAAGCAGGTC
TTTTCAATCACAAAGTCGCAGTCGTGACGGGTGGCGGGAC
TGGCATTGGAAAAGCCATCACTTCTGAGCTCTTACAGTTA
GGATGCAGTGTGGTTATATCGTCCAGGAAGCTGGAGCGTC
TGAAGTCAGCAGCGGAAGAGCTGACACTGAAAATCCCTTC
ATCCAGTCCAGCTAAAGTGACCCCTATAGAATGCAACATC
CGCAATGAAGATGAGGTCACAGTATTATAAGTCTGCATAT
GCAAATACACTGCCTTTATGCCAGAGAATTCTTTAAAGAA
TAACCATTTAAAAAGTCATATTTTGGTTTCCAGTTGAATG
TTTTCCTAATAATAGCCATACACATTTATTACACATAATA
TGATTGAAAATGTATGTACACGTAACTTAATGTTTTTGAT
TTTAAATATATTTGGCATTTCTTCCAAATTTTAAATAATT
TTTTTTATTGCATAAAATAACAAAAATGTCATGGTTTTAT
TCTTTTTTTTTTTTTTTAGATAAAACAAGAGTTAAAAAAA
ATCTTATGTTTGGTGGGATAACAAATGACAACATTTTAAC
ATTTTTATTTTGGCCAATTGTCACATTTTGAGTAATTAGA
AATTACCTAAATGACAAGACTTTACCTTAAAATTTCTAAG
AAATGTCATCAGACCTTTATAGTATAAACAAATCTCAGAT
CTCAAAACACAGAATCTGCAGACATCTTTTGCTATTTCTG
CACAGAATGTTGTACAAAATGTGCAGATTTATGCTGAATG
ATTTCTAAGTGAGG

pecr TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pecr-201 (1)    Ensembl 1278
ncRNA pecr-002 (1)    Ensembl 785
pecr-003 814
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pecr-003 Contained in:
[BAC] DKEY-31D5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000050594 (1),  Ensembl_Trans:ENSDART00000154610 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK018792 (1) 860 nt
GenBank:EB978888 (1) 697 nt
CITATIONS (2)