ZFIN ID: ZDB-TSCRIPT-131113-269
Transcript Name: pecr-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050593 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050593|OTTDARG00000035547|ZDB-GENE-050417-232 pecr|no_translation pecr-002 LG_ BX323548.13 Danio rerio protein_coding KNOWN, 785 bp
CTCTGGTTGTTTCGCTGTCGTAGTCAACATGGCAGCGTCC
AGTGTTTTTAAAGCAGGTCTTTTCAATCACAAAGTCGCAG
TCGTGACGGGTGGCGGGACTGGCATTGGAAAAGCCATCAC
TTCTGAGCTCTTACAGTTAGATGGCATTGCTTGGCCTTTG
TAGCAGCATCAAACTGCTCCTCACAAACGAGGTGTTGTGA
TCATATATTAACTGAAATTCTTCACGCCGCTGCTTGAGGA
TGCAGTGTGGTTATATCGTCCAGGAAGCTGGAGCGTCTGA
AGTCAGCAGCGGAAGAGCTGACACTGAAAATCCCTTCATC
CAGTCCAGCTAAAGTGACCCCTATAGAATGCAACATCCGC
AATGAAGATGAGGTGAAGAACCTGATGGCCTCTACACTAA
AGCTTCACGGGAGAATCGACTTTTTGGTGAATAATGGAGG
TGGCCAGTTTTCCAGTCCGGCAAACATGATGAGTGCAAAA
GGCTGGAAGGCTGTGATCGACACCAACCTCAATGGAACGT
TCTTATGCTGCAGAGAAGCATATAATGCCTGGATGAAGGA
CCATGGAGGTGTAATCGTGAATATCATTGCTGACATGTGG
AAAGGCTTTCCTGGAATGGCGCACACAGGAGCAGCTCGAG
CAGCGGTGGACAACCTGACCAAGAGTTTGGCCATAGAGTG
GGCTCACAGTGGGGTCCGCATAAACTCTGTGGCGCCGGGA
ACAATCATCTCCAAAACTGCTATGGAAAACTACAAAGAAT
ATGGGCCTACTTTGTTTAAGATGTC

pecr TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pecr-201 (1)    Ensembl 1278
ncRNA pecr-002 785
pecr-003 (1)    Ensembl 814
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pecr-002 Contained in:
[BAC] DKEY-31D5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000050593 (1),  Ensembl_Trans:ENSDART00000156315 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DN768226 (1) 792 nt
CITATIONS (2)