Transcript

pbx4-202

ID
ZDB-TSCRIPT-131113-3368
Name
pbx4-202
Previous Names
  • pbx4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049661 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049661|OTTDARG00000034959|ZDB-GENE-000201-18 pbx4|OTTDARP00000038956 pbx4-002 LG_ CU302192.15 Danio rerio protein_coding KNOWN, 827 bp
GCTGAGGGAACAGTCCCGCACACGGCCCATCTCACCCAAA
GAGATCGAGCGCATGGTGGCCATCATCCACCGCAAGTTCA
GCTCCATCCAGATGCAGCTCAAGCAGAGCACCTGCGAGGC
CGTCATGATCCTGCGCTCCCGTTTCCTCGACGCCAGACGT
AAGAGACGCAACTTCAATAAGCAGGCCACAGAGGTGCTGA
ACGAGTACTTCTACTCTCACCTCTCCAACCCGTACCCCAG
TGAGGAAGCCAAGGAAGAGCTGGCCAAGAAGTGTGGGATC
ACTGTCTCTCAGGTCTCGAATTGGTTTGGCAACAAGAGAA
TTCGGTACAAGAAGAACATTGGTGGATATCCTGCACCGTG
CTACACACCTGACGGCAGGCTATGAAGATCTGTCAGCAAG
TCCTCTTTACACCCCACACCGTCTAGACGCTAATAACAGC
TGGCAAGACAACACCAACCCTTCCTCCATCACCTCTCCAC
CAGGAGCACCCGGCAGCATCCACTCCGACACCTCCAGCTA
ATCTCACACACACACAATGGTCTTCCTCCGTCCTTGTCCA
CCTCTACACACACACACACACACACACACTCGTCTCGTTC
TTTGAGGACGAGTCTGAAAACATGACTCGTCTCCTGGATC
AAACCCCTCTACGATGGCGATTACGCAACTACTCCCTCCT
CGCTTGTACCAAAGTGCTGTCAACGGTTGTTTCACTTTTC
CGCACGTCGAAGAGCAACCTCAGACAACTGACCGCCCATC
CAGTCTGCTTTTCACTATGATTTCCGCTACGTTGCGTTAA
GCACAAATCCTGTCACTAAACACTGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations