Transcript

pbx4-201

ID
ZDB-TSCRIPT-131113-1768
Name
pbx4-201
Previous Names
  • pbx4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049660 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049660|OTTDARG00000034959|ZDB-GENE-000201-18 pbx4|OTTDARP00000038955 pbx4-001 LG_ CU302192.15 Danio rerio protein_coding KNOWN, 4379 bp
GGGGCAAGTCTTTCTACGACAGCACCGCGGCTTGGGAACA
AACCAACTGTGTCGGGTCGGCTGGCATGGAGCTGAGCGTT
TCCATTCTGAGTCGTTTCGAGCCGTCCGCCTAGAGCCGGG
GCATTTCGCGCAAGGCCGGGGGCAGTTTTGCTGTTGGTCC
CGGGGGTTTGTGGAGCCCGAGTGAATCTGTTGCTAGCAGC
GCTCGAATGCTAGTTAGCCCCGCTGCTAAGCAGCTAGCCA
ACACTGCGAGTCAATTGTGTCGGAGATCTCGGAAATACGT
TTAAAAGCGGTCACGTTCACCCGCCGCTCTCGCGATTCGT
TTTGCTCGTTGAGTTTCGTCTTTTTCCCCAGCGGGAGGAC
GCTAATAAGCGGTCGCGCGAGTTTCTATTTCGATTTATTT
CCAGCTAAGACTTTTTTTCTTCTCTCTATTAGCTTGTTAG
CCGCTCTGGTTGGTTTAGTCCAGCTTGTTAGTAGTGTCTG
AGATTTCTACTGTAATAGCTGTCAGCGACAACAGCCCCTT
GACGAAAAGCCAGTTTATGTGGACATGAATGATCGTGTTT
GGTTGTTTCGAGTGGCGATAGTTTGAGATGCCGCGCATGG
GATACTTCATGTTTCCAGGGACGCTCTTATTTTCTTGTTA
GTCTGCTTTATGGGAGTGCTAGTGTGCAGCCTTTTGCTGT
AGACAACACTGGTTTTTAGCAGGAACCGCACGCGGTGTTT
CACCATCGGTCGCGCGTCGTTTGGATGTGGTTCAGCCTCA
CATTTCAGTCGCACTCTCGTTGTTTGTTTTCTTTTTTTAT
CTAGTGGCTCGTTCAGCTCCGCGTTTGTATCCGCGCTGTC
GGTGGTACATGCTCACTGAGACAGCCCGCTGAAACACGCT
TTCATTGGTTTGCGGCGGGGAAACGGAGAGATTCGGCTCA
AAAGTATTATGGATGATCAGACCCGAATGCTGGCTAGCAT
GGGCGGACTCGGCGGACTCTCGCAAGCCGACGTGGGTGAC
CCCGATTCGGTTCGGAAGCAGCAGTCGCTCGGTCAACCGC
AGCAAGACATAGGAGATATCCTCCAGCAGATCATGGCCAT
CACCGACGAGAGCCTCGACGAAGCCCAGGCGAGAAAACAC
GCACTGAACTGCCACAGGTTGAAGCCAGCTCTCTTCAGTG
TTTTATGCGAGATCAAAGAAAAAACTGTGCTGAGCATCAG
AGGCGTGCAGGAGGAGGATCCTCCAGATCCACAGATCATG
CGTTTGGATAACATGCTGCTGGCTGAGGGCGTCTCTGGGC
CAGAGAAGGGTGGAGGATCTGCGGCGGCAGCAGCAGCTGC
AGCGGCAGCTGGAGGATCACCTAATGATGGCAGCATCGAA
CACTCCGACTACAGAGCCAAACTCGCACAGATCCGCCAGA
TCTACCACTCCGAGCTGGAGAAATACGAACAGGCCTGCAG
TGAGTTCACCAATCACGTGATGAACCTGCTGAGGGAACAG
TCCCGCACACGGCCCATCTCACCCAAAGAGATCGAGCGCA
TGGTGGCCATCATCCACCGCAAGTTCAGCTCCATCCAGAT
GCAGCTCAAGCAGAGCACCTGCGAGGCCGTCATGATCCTG
CGCTCCCGTTTCCTCGACGCCAGACGTAAGAGACGCAACT
TCAATAAGCAGGCCACAGAGGTGCTGAACGAGTACTTCTA
CTCTCACCTCTCCAACCCGTACCCCAGTGAGGAAGCCAAG
GAAGAGCTGGCCAAGAAGTGTGGGATCACTGTCTCTCAGG
TCTCGAATTGGTTTGGCAACAAGAGAATTCGGTACAAGAA
GAACATTGGTAAGTTCCAGGAGGAAGCAAACCTGTACGCC
GTTAAAACAGCCGTGGACGCCGCCAATGTGTCGGCACAGG
CCAGCCAGGCAAACTCTCCAGCAACACCCAACTCAGGTGG
ATATCCTGCACCGTGCTACACACCTGACGGCAGGCTATGA
AGATCTGTCAGCAAGTCCTCTTTACACCCCACACCGTCTA
GACGCTAATAACAGCTGGCAAGACAACACCAACCCTTCCT
CCATCACCTCTCCACCAGGAGCACCCGGCAGCATCCACTC
CGACACCTCCAGCTAATCTCACACACACACAATGGTCTTC
CTCCGTCCTTGTCCACCTCTACACACACACACACACACAC
ACACTCGTCTCGTTCTTTGAGGACGAGTCTGAAAACATGA
CTCGTCTCCTGGATCAAACCCCTCTACGATGGCGATTACG
CAACTACTCCCTCCTCGCTTGTACCAAAGTGCTGTCAACG
GTTGTTTCACTTTTCCGCACGTCGAAGAGCAACCTCAGAC
AACTGACCGCCCATCCAGTCTGCTTTTCACTATGATTTCC
GCTACGTTGCGTTAAGCACAAATCCTGTCACTAAACACTG
AGCTGGTGTTCGGGTGGAGAGGAGTTAAAGGTACGCTGGA
CCTATGAACACTTTGATTTCCAGTTCAGCTGAACGCAATG
AGCGACCGCTCTCCGTTTTTAGTTTTCGCCACAGTATTCG
TTTCCCTCGCCCGCAGCACGAAGATGCACCAGCCACCAAA
TAAAAAGACTTGATAAGAACTAGACCTCGCGTTGGTAAAA
CGGGGTCTGTCAGATGGACGGATAAGCTGGAGTATTGGTT
TGGATCGGGGATCAGGGGGTGGGTGTTTAGAAATATTTTT
AAAGGGAAAGATGATTAAAAAAAAAGCGATATTCCACTGT
CTTCCATGCATGTAGGGTGTGTTGAGATGTTTTAGTGATT
CCATTTAGCCTAACGTTACGTTTTTCTTTTAGTTTTTTCC
TTTCGTTTTTTTAATAAACAAAAAAAAAAAAACTAAATAT
ACTATAAAAGGAGAGGGTGGGAAAGTAACAGACCAAATAA
ACAAGTGAACAAGTAAAAGGACGTCATACTGCCCGGTGAT
CCAGTGCTTCGGGCTGGGGTTTGGTTTCTCTAGGGTTTCC
GTGGTATTTTAAATAGCACGTTTTTTTTTTTTCATCTGTG
ACACACACTGCGGCCTCTCGTCTTACTGGTGTGTGTTGTG
TGTTTTCTAAGGGTTGGGTTGTCTCGTCACTCACTCGTGC
TTTTGAACTGATTGTATTGTACGTGCAATTGAAAGCACCT
GTTTCTTGGTAAAGCATGCTGTCTCTCTTTAATTTGACCT
TTTTTATTTTTACGTTTTGTTGTTGTTGCCTACAATTTCA
CTAAACTAAGGAACTCTGTTTTTTTGGTAATCAGTTAACA
TAGCCAAGCAACAAGGGCTTTTCTCCTGTCGAAATTTAAC
CAAAAATAAGCACTGGATGTGTTGTGATTTGAAACAGATG
GACCACAGCTTGTAGAGGATTTTTTTTGTTTTCCCGAAGT
TACAGAGAACGAGTTGTCCGTGTTTTTCCTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTAAACGTTTCTCCGTTTAGTTT
TCTCTTTATGGGCGGAAGCAGCAGGGCGTTTTTGATATAT
GAATGGAAATTCTATATATTACACAAAGGACTAAATAAGG
TTGAAATGTAAATTGGGGTTTTGTTTATATATGTACACAT
GGAAAAACAAACTCTGAGGAGCTTTTCAAGCGTTTCTTCA
AGATCATCACCGTGTCCTCTATAGATTAGTTCGAAACATT
TCATATGGATATCTCCGACTAATGCTATTACTACACCAAA
ATTTCTTTCTTTTCTTTTTTCTATCAGTCATCTATGGATG
TCACTGTACAGATTGTGGAATGTTTCAGTGTATTTTTCTC
TTTTTGTATGCTTTTGCTTTTTTATTATTTTTAAATTCTC
GCTGGGGGGTTTTGGAGTAACATTTGTTAGTCTTTGTAAT
ATTCATTTTAGCGTTTCAGTTACCTTTTATTTGGATCGGG
AGTCTCGAGTGTTATTTTGTTTGTGTGGTTTTGTCAAAGC
TGATGGCGTTTGTTTGAAGTGCCGTTAAACAAATTTTACA
GGATCAACCGTCTTATTTGAGTATCTGCATAAGCTACGCT
ACAGACGATACGATACACTACATGTTGGACAATTTGTCAC
ACAACTCTGGGATATTTTGGATTGTAATCGGAGTTTGAAT
CCGCAGCACCGACTCAAACGCCATCAGCATTTTATTTCTC
GATTATTATTATTATTTTAGTAGAATTGTAGTACACGCTT
CCTTCTGTATTTACCATTCTCTCCCTCCTCTCTACCTCTC
CTCTCTCCATTTCACTTGTATATAAACCCCCCCATTTTCA
GACTTGGTAGTCTGTATAAACTCCTTTTATACCTCAACTT
TAGAACTGTTCTAGTGAGAGAGAAAAAAAAGAAATATGAG
AAAATTGTAGTGTTCCTTATTAGAAAAACAAAAACTAATA
AAATAATCTAGTGTGCTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations