Transcript

zgc:112964-002

ID
ZDB-TSCRIPT-131113-3302
Name
zgc:112964-002
Previous Names
  • ch73-329n5.4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047794 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047794|OTTDARG00000033841|ZDB-GENE-050306-47 zgc:112964|OTTDARP00000037518 CH73-329N5.4-002 LG_ CU914622.9 Danio rerio protein_coding KNOWN, 447 bp
TTCAGATTCTCTGAAAGCAATTATAGGCTTGCAATGACAT
TCTCATACTTCTGACCTCCGCACATTTATCATGAGGGTGT
TTTCAGCTTTACAATATCTGCCGGTGTTCATATCAGTCTT
TTCTCTGAGCTGGGTGACAAAAGCACAGACAGGCTGGTTT
TGACACGATAAACTCAACAGCGTACTATGTTATTCCTGGG
TCAAACAATGGGACCCTTATTCCAAACCTCATGAACTCCA
GTAATGTCAATGTTCCTGGTCGATGGGTCTTCAGGGTGAA
TGGAGGATCCAGTTTACAAGAAAATGTCATGGGAATTCAA
CTGAGAGTTACTTCATTTTCAGACCTAACACTGACAAAAA
ACATTGAGATCTTTTTAAAGGAGCTACAAGAGGAGCTGGT
CAAATACGGTCTGCCAGACAGCGTGAAGCTTAACTTAAGA
GGAATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations