ZFIN ID: ZDB-TSCRIPT-131113-1680
Transcript Name: zgc:112964-201
Previous Names: ch73-329n5.4-001, zgc:112964-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047695 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047695|OTTDARG00000033841|ZDB-GENE-050306-47 zgc:112964|OTTDARP00000037456 CH73-329N5.4-001 LG_ CU914622.9 Danio rerio protein_coding KNOWN, 1882 bp
ACAAACGTACAAAACACATTTGAGTAAGCCTTTTCTGATT
CTCTGAAAGCAATTATAGGCTTGCAATGACATTCTCATAC
TTCTGACCTCCGCACATTTATCATGAGGGTGTTTTCAGCT
TTACAATATCTGCCGGTGTTCATATCAGTCTTTTCTCTGA
GCTGGGTGACAAAAGCACAGACAGTGCCTGTGATGTTCTA
TTCATTCGGCTCAGAAGCAGGAGACACTGTTTATACCGCT
GATGGCAATGAAAACTCCACAGTTATCAACCTAGAAAGTC
CTTTTGTGTTCTTTGGCCGCACATACAACAATATATATGC
TAACATTAATGGATACCTTACATTCAAGCAGCCTTCATCA
GATTACACTTTTCAGTACTTTCCCATCAACGGAAGCGAAG
ACATCATTGCTCCACTCTGGACCAATGCTGATGTCAGCGG
AAATGACATCATTGCATACCAGCAGTACTCAAGTGGAGAT
GTGCTCACTCGCACCACTCAGGATATAAACCATTATTTCC
CAAATCTGAGCTTTAGGGCTACTTGGGTGCTTGTTGTAAC
ATGGGATCAAGTGGACTATACTTACCAATCTAACGCAGCA
TCACTGTTTCAAGTGGTTTTGGTTTCAGGGAGTGATGTGT
CATTTATTCTCATGAATTATGGTGACTGTGCTCTGACGCA
AAATATGGTGCAGGCTGGTTTTGACACGATAAACTCAACA
GCGTACTATGTTATTCCTGGGTCAAACAATGGGACCCTTA
TTCCAAACCTCATGAACTCCAGTAATGTCAATGTTCCTGG
TCGATGGGTCTTCAGGGTGAATGGAGGATCCAGTTTACAA
GAAAATGTCATGGGAATTCAACTGAGAGTTACTTCATTTT
CAGACCTAACACTGACAAAAAACATTGAGATCTTTTTAAA
GGAGCTACAAGAGGAGCTGGTCAAATACGGTCTGCCAGAC
AGCGTGAAGCTTAACTTAAGAGGAATCAAAAAGGCCCAGC
CATAATATCAGCCTCATGAGAAGACATATGTGTAATATAT
TATAAATATTCCTGTCATTGAATATACCAAGAAAGCAAAA
ACAATAATATACTGAATGAAATGTTAAATTGCAGCCATGC
CAGTTTTTAGTTAGCACCATATAATTTACAAAATAGGGAA
GATAAACCTGTGCTTCCTCTACTTGCTACAATCATAACTT
GATCATTCATTCATTCATTCATTTTCCTTCGGCTTAGTCC
CTTTATTCAACAGGGCTTGCCACAGCAGAATGAACCACCA
ACTTATCCAGCATTTGTTTTACACAGCGGATGCCCTTCCA
GCTGCAACCCAGTACTGGGAAATAACTTGATCATATATTA
GGACAAATATTTATGCCAATCAGATTGTATTTACACTGTT
GTTGCTCAAGGAAAAAAGGATGGAGGTCAATAACTCTTTT
TAAGAGCATTCCGCTGTGGTGACCCTTGATGAATAAAGGG
ACTAAGCTGAAAAGAAAACGAATGAATGAATAAGCCAATT
AAATTGAATGTAAAATGTCATGTATGTTTCTTTGCTCACC
ACAAGAGGGAGCAAAACGCTAATTCTTAGACTTGGAGTGA
AGACACGCCTTGAAATGTGAAACTTTGCGTTTGTGATTTA
GAAAGGAAGATGTCATTGTGACCCACGGTTTACCTCATGG
GTTTAAGCTTGACCCCCATCATCATATTACTAACATTTAA
AGTTTTGACATTGTTTCAAAAGCCTGCCATACCATTTTTT
TCATGACCGGTCAGTCTGTTGAGTAGTAAATTGATGTTAT
TTGGTAAGTGCCTTAAACTGTTGTTTAAGTGATGTGACCT
TAACTGCCCATTCAAAAAAAAATTGAATAAAAACTTTAAT
AT

zgc:112964 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:112964-002 (1) 447
zgc:112964-201 1882
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:112964-201 Contained in:
[BAC] CH73-329N5 (1)

Genome Resources: Vega_Trans:OTTDART00000047695 (1),  Ensembl_Trans:ENSDART00000170723 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC090736 (1) 1930 bp
GenBank:EH441913 (1) 1033 bp
GenBank:EH455989 (1) 928 bp
GenBank:CB361609 (1) 404 bp
CITATIONS (2)