ZFIN ID: ZDB-TSCRIPT-131113-3231
Transcript Name: mis18bp1-201
Previous Names: dkey-11j8.1-002, mis18bp1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033001 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033001|OTTDARG00000025087|ZDB-GENE-030616-151 mis18bp1|OTTDARP00000026688 DKEY-11J8.1-002 LG_ BX465838.15 Danio rerio protein_coding KNOWN, 3954 bp
ATAAGTCCTATTTTCCATTACGCTGGTTTTGTTAAGCACA
AGGATGACAGAGGGACTATAAACGGTTAGGCACTTTTCTC
TAACACAAAAGCAATGTATCACCCACTACAGGACTATTTC
ATAGCACCTGGAGTCCCTAAATCTAGTGACATGATCACAC
CAGTCAAAACTAAACCTAAAATAGCCAGCAGTTGGGCACC
TGGGTCAGGTAGAAAGCTTTCAAACAGAGATGTGTTGGTG
ATGAACTCCACAGCTCAGAGTGCTGAAGAAAACAGCCCAA
ATATCCCCTGTGAGCTCAGCAGCATCAACGCCACGGCGGA
TGTTGTGCCTCAAAACAAAGCTGACCTGATGCTGAAGAAG
GGCACTGAGACGCCAGCAAAGATTTTTGCAAGAATGAAAG
CAAAAGTTCAGAGACAAAATTCTGCAGGGCACGAGGCAGT
TTCTGTTCATGTAAAAAATCTAGAGATTTGTAATGTTGAC
CAGTCAAACCCTGTAATCCAGATATCACGTAAGACTAACA
TCAGCCAGGAGACTTATGTGATCGCCGTTTCACCTCCACA
GTCGTCACAGCCTGAAGAAACAGACTCATCACAAGAAAGA
TCTGAAAGACAAATTGAAGTTTTAAATACTGAGTCAGAGT
CATTTATTGCACCGTTTGCTTTACTGGAAAAGATGCCCAG
GGTTATGGAAGCAAAACGAAAACAAATGCCAGAGAATCCT
TGTAGGGGAAACAAACAGCCTCTTGTGCTTCTGGAGAAAG
TGGTTCCAGTTGAGATGTTGGCCCAGCTTCAGCAGAAACC
CGTCAGTTTTGTCAGTGGGTTGAAGGACATCAGAAATAAA
GGTACTTGTGTTGTCTTTGGCGAGAGGAGCATTTCTGAAG
AAAAAGACAACGAGAAAGACCTCCAAATAGAGCAGTCCAG
TAGTCCTGAGTCTGATCCATTTAGTCGGTCTGAGTCTCAG
TCGGATTGCACCGAAATGGTCCCTGGACCCACTCAGCCCA
ATCATAATCTGCTGGATGATCCTCTTCTGCTGCTTTCTCC
TCGTGTCCTGATCCCACGAAAGCAAGCATCTGTGCTTCAG
TCAAAACGACAGGCCAGACAAGTGGATGAAGCTGTAGATG
AAGCAACCAATGTGACAGGGATTCATTTAAGAGACTGGAT
TGTGAAGTTGCTCAACAAAGAGCTTGTGGTTGATGGTATT
CGAATAGACACCATGATACCATGGCACAGCAGTTTTATTG
TCGAAAGAGTCTCGAGTAATGTCCTCAAGACGTCATCCGG
CAGGACTTACGTTCTGATTGGGAAAATGGCCAAACATCCC
AATTCATTGTTTCCATCGTGGTTTTTAAAGAAGTTTCTTT
TTGGGTTTCCAAAAATGTGGAAGGAGTACCTGGATCAGTT
TTTGAGTGCTTATACAGGATCACAAAAAAGTCAAAAGGAC
AAAAGCAGTTCTGTGAAACCTTCTAAAGCCAGAAAAAACT
CAACATCCAAACATTCTAAGGTTCAAGACATTACAACGTC
TCCTGTCACTCCCATTGATGGTGTTCAGCAGGACAGTGCA
AAAGTGTCCCGCAGTGGCCGACTCATCAAACCACCACTGG
AGTACTGGAAAGGAGGGAGGATTGTTATGGACTCTGAGAT
GAACGTTACTGTCCATGAAGACTATTCAACCTCAGTACCA
TCCACGCCAAAGAAGCCGGCAACATCACAGATTGCAGAGG
AAAAATCATTCAGACCCAAAACTGTGGAAAGAGGGAGATG
CATCACATCTAGCAGTGAAGATGAATTATCAGTGCCAAGA
AGGAGAATCAAACAGGTTTCCAAACCCCAACAGAAGATAC
CCAGCAATCCACTTCCGGCTGAGAACACAGCACGGAGTAA
ACCTCCAAGATCTCAGAAAGGGCCCCTGGTAGTGACCACC
ATGTCTGATTCAATTCCTGCAGCAAAACAAAACGCTAGTA
GACCTCAAAGAGCCTCTCTGAGAAAACAGCGTTCAGCAGA
AAAGGATACCTTTCTGGATTCAGGGACCGAAATGAAGGAA
AAGACAAAAGTTGATGCAGTAAATGGTAATTTCATTCCTG
GAGATGAACAGGAGACCGGCTCAGAGGAAGATCCAAAATC
AAAGCGTAACAGCAAGTCCTCCCAAAAACAAATTCAAGTT
GAACCTCAGCCCCTGCCACACGACTACAGTTCTTTACGCC
GAAGCTCTCGCATAAGCTCCAGAATCATATACTCTACAGA
CTCAAACAGCTCCTTCACTTCTCCAGACCTTCCAAGAAGG
CAAAGAGAAAAAAAGTCTACAGCCCAGAAACAGCTAACCA
AATCTCTAAGGACCTCTGTGCTGCAAAACTCTATTGGGCA
TAAGGAACAAAATGATCAAGAATCAATGAGATGTTCACAA
AGACCAAAAGTTATCTCACAAAAAAGTCCAGATGATGTGT
TGGTGGATGCTTCTATATCTCTTCTCACAGACGATAATGA
TGATGAAGACCGAGTACAACATGAACAAAAGGCCACATTA
TTGTTGAGAAAGGCAAAACCAAGGAAAGGTAAATCCCAAC
CTAAAAGTATTGGAACCCCAGTTTCCTCAGAAAGCATGCA
TTCTGAGCACTCGGAGGATGAGGAAAGTGTTTCAAATAAC
AGAAGATCAAAGAAATCTGAAAAGGGAAAAGCAAACAGTA
GAAGCAAAAAAACCCAAGCAGAAAACAACATGCTTAATAA
ACAAGAGGAGCTATTGGATGGAAAATGGACTGAAGAAGAG
CTGCAGAAACTACATGAGGGTGTCAACTCATTACCCAAAC
ACCAGAGCGGTTACTGGGCACATGTTGCATATGTTGTTGG
CACCCGGTCTGCTGAAGAGTGTCATGAACAGTATAATGCC
CATCAGAGGAAGAGCAAAATCCCCAGACAAAGACCATCAA
AGAAACCAGCGGCAACTGAGGAGTCAAGCAAGGAAGTAGT
TGAAATCACTGCTAAAGCTGGAACACTTAAAAGAAGACAT
CAGATGAGACATTTCTTGGAGCACATGCCCAAAGATGACC
ATGATGACGTGTTTACCAGCTCGCCCATGCACAGTAAACA
AATCAAGTTGCCTGTATTTGCTGCAAATGGAGATGATAAG
GATTTCAGCCAGCTTCAGAACCCTCAGACTCCCAGTTCAA
GCATGTCTACTTCTGCTAAAACCCCTCAGTGTTTACACAT
CAGCCCAGGAATGATGGGTTCTATAAATAAGAATAACTTG
GATAAGTACATTTTCCATCTTCAAAAGAACCAAAAAGGAA
GAAAACGAAACAAAAAGGTTGCACAAACGGAGAAGCTTAC
ACCAACCCCAGCTGCCAGGAAGACCCTAAAAAGATGTGTT
GCTGAAGATGATGACTTTGTGGTGTGGAATATGCTCTCAG
ATAAGGATATGCCATCCAGAGAAGATGACAGTGACGAGGA
AGATGATTATTTTATGGAATATTGCTGAGCTGCACTATCA
CTGTTTGGAATTAGTAAAAAGTATCTTAAAGAGTTAGTGT
CAGTGCCGGTAATCGCATTATTTTACAATATTTTAGCTTC
TACTTAGCATCCGGTTAATTTTAATTGTGTTTTGTTTTGT
CAAACACTGAGGCTCATAAAATGTTTGCTCTCCATGACTT
CTAAAATATCACACATCATTTTTTTAATGGCCATTGTTTT
GTTTAGTTTATCTGCAATGCAGAGTTTATCAGTGGATCGT
GTTTTAATTTGGAGTTTTTGAATCTGCAGATGTTGATTCA
AGTTGTAATGAAATAAGTTTCATAAAACAACGTTCAAAAG
AAACGAGTTCTAATTATTCCTCACTGTGTAAGAAACAAGT
TGCTTTAACAGAGAATGTAAATGTGCCATTTTTAATTCTT
TTATTTGATTTATATTGTAAATACATATCTAAGCAAACAC
AATGTATAAACAAATAAAATTATTAAAATCTCAA

mis18bp1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mis18bp1-201 3954
mis18bp1-202 (1)    Ensembl 4010
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mis18bp1-201 Contained in:
[BAC] DKEY-11J8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000033001 (1),  Ensembl_Trans:ENSDART00000113300 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI562806 (1) 473 nt
CITATIONS (2)