ZFIN ID: ZDB-TSCRIPT-131113-1630
Transcript Name: mis18bp1-202
Previous Names: dkey-11j8.1-001, mis18bp1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032999 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032999|OTTDARG00000025087|ZDB-GENE-030616-151 mis18bp1|OTTDARP00000026686 DKEY-11J8.1-001 LG_ BX465838.15 Danio rerio protein_coding KNOWN, 4010 bp
ACTGGCGGAAATGACGCAGCCCTTACGCGACGCGAGACGT
TAGCCGCTCATTATCCGGGAAAATTCAAACGAGTTTTATG
GGTTTTGTTAAGCACAAGGATGACAGAGGGACTATAAACG
GTTAGGCACTTTTCTCTAACACAAAAGCAATGTATCACCC
ACTACAGGACTATTTCATAGCACCTGGAGTCCCTAAATCT
AGTGACATGATCACACCAGTCAAAACTAAACCTAAAATAG
CCAGCAGTTGGGCACCTGGGTCAGGTAGAAAGCTTTCAAA
CAGAGATGTGTTGGTGATGAACTCCACAGCTCAGAGTGCT
GAAGAAAACAGCCCAAATATCCCCTGTGAGCTCAGCAGCA
TCAACGCCACGGCGGATGTTGTGCCTCAAAACAAAGCTGA
CCTGATGCTGAAGAAGGGCACTGAGACGCCAGCAAAGATT
TTTGCAAGAATGAAAGCAAAAGTTCAGAGACAAAATTCTG
CAGGGCACGAGGCAGTTTCTGTTCATGTAAAAAATCTAGA
GATTTGTAATGTTGACCAGTCAAACCCTGTAATCCAGATA
TCACGTAAGACTAACATCAGCCAGGAGACTTATGTGATCG
CCGTTTCACCTCCACAGTCGTCACAGCCTGAAGAAACAGA
CTCATCACAAGAAAGATCTGAAAGACAAATTGAAGTTTTA
AATACTGAGTCAGAGTCATTTATTGCACCGTTTGCTTTAC
TGGAAAAGATGCCCAGGGTTATGGAAGCAAAACGAAAACA
AATGCCAGAGAATCCTTGTAGGGGAAACAAACAGCCTCTT
GTGCTTCTGGAGAAAGTGGTTCCAGTTGAGATGTTGGCCC
AGCTTCAGCAGAAACCCGTCAGTTTTGTCAGTGGGTTGAA
GGACATCAGAAATAAAGGTACTTGTGTTGTCTTTGGCGAG
AGGAGCATTTCTGAAGAAAAAGACAACGAGAAAGACCTCC
AAATAGAGCAGTCCAGTAGTCCTGAGTCTGATCCATTTAG
TCGGTCTGAGTCTCAGTCGGATTGCACCGAAATGGTCCCT
GGACCCACTCAGCCCAATCATAATCTGCTGGATGATCCTC
TTCTGCTGCTTTCTCCTCGTGTCCTGATCCCACGAAAGCA
AGCATCTGTGCTTCAGTCAAAACGACAGGCCAGACAAGTG
GATGAAGCTGTAGATGAAGCAACCAATGTGACAGGGATTC
ATTTAAGAGACTGGATTGTGAAGTTGCTCAACAAAGAGCT
TGTGGTTGATGGTATTCGAATAGACACCATGATACCATGG
CACAGCAGTTTTATTGTCGAAAGAGTCTCGAGTAATGTCC
TCAAGACGTCATCCGGCAGGACTTACGTTCTGATTGGGAA
AATGGCCAAACATCCCAATTCATTGTTTCCATCGTGGTTT
TTAAAGAAGTTTCTTTTTGGGTTTCCAAAAATGTGGAAGG
AGTACCTGGATCAGTTTTTGAGTGCTTATACAGGATCACA
AAAAAGTCAAAAGGACAAAAGCAGTTCTGTGAAACCTTCT
AAAGCCAGAAAAAACTCAACATCCAAACATTCTAAGGTTC
AAGACATTACAACGTCTCCTGTCACTCCCATTGATGGTGT
TCAGCAGGACAGTGCAAAAGTGTCCCGCAGTGGCCGACTC
ATCAAACCACCACTGGAGTACTGGAAAGGAGGGAGGATTG
TTATGGACTCTGAGATGAACGTTACTGTCCATGAAGACTA
TTCAACCTCAGTACCATCCACGCCAAAGAAGCCGGCAACA
TCACAGATTGCAGAGGAAAAATCATTCAGACCCAAAACTG
TGGAAAGAGGGAGATGCATCACATCTAGCAGTGAAGATGA
ATTATCAGTGCCAAGAAGGAGAATCAAACAGGTTTCCAAA
CCCCAACAGAAGATACCCAGCAATCCACTTCCGGCTGAGA
ACACAGCACGGAGTAAACCTCCAAGATCTCAGAAAGGGCC
CCTGGTAGTGACCACCATGTCTGATTCAATTCCTGCAGCA
AAACAAAACGCTAGTAGACCTCAAAGAGCCTCTCTGAGAA
AACAGCGTTCAGCAGAAAAGGATACCTTTCTGGATTCAGG
GACCGAAATGAAGGAAAAGACAAAAGTTGATGCAGTAAAT
GGTAATTTCATTCCTGGAGATGAACAGGAGACCGGCTCAG
AGGAAGATCCAAAATCAAAGCGTAACAGCAAGTCCTCCCA
AAAACAAATTCAAGTTGAACCTCAGCCCCTGCCACACGAC
TACAGTTCTTTACGCCGAAGCTCTCGCATAAGCTCCAGAA
TCATATACTCTACAGACTCAAACAGCTCCTTCACTTCTCC
AGACCTTCCAAGAAGGCAAAGAGAAAAAAAGTCTACAGCC
CAGAAACAGCTAACCAAATCTCTAAGGACCTCTGTGCTGC
AAAACTCTATTGGGCATAAGGAACAAAATGATCAAGAATC
AATGAGATGTTCACAAAGACCAAAAGTTATCTCACAAAAA
AGTCCAGATGATGTGTTGGTGGATGCTTCTATATCTCTTC
TCACAGACGATAATGATGATGAAGACCGAGTACAACATGA
ACAAAAGGCCACATTATTGTTGAGAAAGGCAAAACCAAGG
AAAGGTAAATCCCAACCTAAAAGTATTGGAACCCCAGTTT
CCTCAGAAAGCATGCATTCTGAGCACTCGGAGGATGAGGA
AAGTGTTTCAAATAACAGAAGATCAAAGAAATCTGAAAAG
GGAAAAGCAAACAGTAGAAGCAAAAAAACCCAAGCAGAAA
ACAACATGCTTAATAAACAAGAGGAGCTATTGGATGGAAA
ATGGACTGAAGAAGAGCTGCAGAAACTACATGAGGGTGTC
AACTCATTACCCAAACACCAGAGCGGTTACTGGGCACATG
TTGCATATGTTGTTGGCACCCGGTCTGCTGAAGAGTGTCA
TGAACAGTATAATGCCCATCAGAGGAAGAGCAAAATCCCC
AGACAAAGACCATCAAAGAAACCAGCGGCAACTGAGGAGT
CAAGCAAGGAAGTAGTTGAAATCACTGCTAAAGCTGGAAC
ACTTAAAAGAAGACATCAGATGAGACATTTCTTGGAGCAC
ATGCCCAAAGATGACCATGATGACGTGTTTACCAGCTCGC
CCATGCACAGTAAACAAATCAAGTTGCCTGTATTTGCTGC
AAATGGAGATGATAAGGATTTCAGCCAGCTTCAGAACCCT
CAGACTCCCAGTTCAAGCATGTCTACTTCTGCTAAAACCC
CTCAGTGTTTACACATCAGCCCAGGAATGATGGGTTCTAT
AAATAAGAATAACTTGGATAAGTACATTTTCCATCTTCAA
AAGAACCAAAAAGGAAGAAAACGAAACAAAAAGGTTGCAC
AAACGGAGAAGCTTACACCAACCCCAGCTGCCAGGAAGAC
CCTAAAAAGATGTGTTGCTGAAGATGATGACTTTGTGGTG
TGGAATATGCTCTCAGATAAGGATATGCCATCCAGAGAAG
ATGACAGTGACGAGGAAGATGATTATTTTATGGAATATTG
CTGAGCTGCACTATCACTGTTTGGAATTAGTAAAAAGTAT
CTTAAAGAGTTAGTGTCAGTGCCGGTAATCGCATTATTTT
ACAATATTTTAGCTTCTACTTAGCATCCGGTTAATTTTAA
TTGTGTTTTGTTTTGTCAAACACTGAGGCTCATAAAATGT
TTGCTCTCCATGACTTCTAAAATATCACACATCATTTTTT
TAATGGCCATTGTTTTGTTTAGTTTATCTGCAATGCAGAG
TTTATCAGTGGATCGTGTTTTAATTTGGAGTTTTTGAATC
TGCAGATGTTGATTCAAGTTGTAATGAAATAAGTTTCATA
AAACAACGTTCAAAAGAAACGAGTTCTAATTATTCCTCAC
TGTGTAAGAAACAAGTTGCTTTAACAGAGAATGTAAATGT
GCCATTTTTAATTCTTTTATTTGATTTATATTGTAAATAC
ATATCTAAGCAAACACAATGTATAAACAAATAAAATTATT
AAAATCTCAA

mis18bp1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mis18bp1-201 (1)    Ensembl 3954
mis18bp1-202 4010
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mis18bp1-202 Contained in:
[BAC] DKEY-11J8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000032999 (1),  Ensembl_Trans:ENSDART00000156711 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC139650 (1) 2650 nt
GenBank:EL652023 (1) 932 nt
GenBank:DV594582 (1) 872 nt
GenBank:CT666299 (1) 868 nt
GenBank:CT666298 (1) 842 nt
GenBank:CT733976 (1) 789 nt
GenBank:EB920257 (1) 627 nt
GenBank:EB930399 (1) 486 nt
GenBank:AW059369 (1) 485 nt
GenBank:BI474987 (1) 439 nt
GenBank:CD604183 (1) 421 nt
CITATIONS (2)