header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-2835
Transcript Name: c4-202
Previous Name: c4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057625 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057625|OTTDARG00000040158|ZDB-GENE-030131-5697 c4|OTTDARP00000045147 c4-002 LG_ AL935181.5 Danio rerio protein_coding KNOWN, 611 bp
TTGACCAAAAATAATGCTCTCACTCTCTCAGCTGTGAAGG
TTGTGCAGACGTACAGAACTATGAAGAAGGATGAATCATT
CTGTGATCTTTTTCACCTTACTGTCACAGTGAAGGGAGAG
CTGGAGTACAAAACCGACAATAGTCAAGATCTGCTTGAAG
ATTATTATGAGAGCTATGACACCAGTGAAGCTCAAAATGA
TGAGCCCATGAGCAACATGCAGTGGTTTGACCTCCGCAGC
CGCAGAAAAAGACAAATCTCGGAGGAGCCGATAAAAGAGA
GTTCTCTCATATACACAGTGTGTGTGGGCCTGAAAAAGAA
GAACTCTGAGGGCATGATCATAGTGGACATTTCTCTTCTG
AGTGGACTGATACCAAACAGCAAAGACCTGGAACATAATG
TAAAGGGCACAGAGAAGTACATCGATCACTATGAAATTCA
CCACAACAAAGTCTATCTTTATTTTGCAAAGATCACTGAA
ACAGAGGAGTGTCTTCAGTTTGGTGCCGATCAGGCTGTTC
CCATGGGTCTCGTCCAGCCTGCTTCTGCTGTCATCTATGA
CTATTACAGTCCAGAGAAGAGATGTGGCATTTTCTACACA
GCGCCTCAGAA

c4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA c4-201 (1)    Ensembl 7274
c4-202 611
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
c4-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000057625 (1),  Ensembl_Trans:ENSDART00000155371 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BI429341 (1) 612 bp
CITATIONS (2)