ZFIN ID: ZDB-TSCRIPT-131113-1233
Transcript Name: c4-201
Previous Name: c4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057624 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057624|OTTDARG00000040158|ZDB-GENE-030131-5697 c4|OTTDARP00000045146 c4-001 LG_ AL935181.5 Danio rerio protein_coding KNOWN, 7274 bp
GTTCTGTTGTAAACACGATTTCTTGTAAATCACATGACTT
CATGACCATGACTTTTTTGCCAAATTTTCCCTTTTTTAAG
TATCAAAGCCAAGTTTGATGAAGGTGGGAAATAGCTTACT
CTTTTCTCAGTCTGTGGATAGCAGACATACTAATGGAATA
ATAAACAACTGCAAGCTAATAAAATCAAGATGATCTATCA
TCTGTTTTTTGTGGTTTTTGGTATTTATGTGGTGGATGCA
CAGAAACCCACATGCCTTATTGTTGCTCCAAATGTAATTC
ACCTGGGAGTGGAAGAGACTGTGGGTGTACAGCTTCATGG
AGCCACTAAAGAAATAAGAATGAAACTGTACTTCGAAAAA
CAGAAAGAATCAGAAATTCTGTCAGAAATAAGATCTATAA
TCCTCAATGAAAACAATAACTACCAGGCTGTGGTAAAACT
CAAGGTTGATGCTACCATGTATGGGGATGTTGAAAAAAAT
TCATATGTTCAACTTGCTGCCATAAGCAATGATATCTTTG
AGAAACAGGATGCCAGAAAAGCCAACATCTATTTGTCAAC
AAAACGGGGTTACATATTTGTCCAAACCGACAAGCCAATT
TATAATCCAGGAGAAAACGTCAAATACAGAATCTTCATTC
TAGACAACTACATGCTCCCCATACAAGATGAACTCCATGT
TCAAATAACCAACTCCAAAGGCTTGATTGTTTACAATCGT
GTTTTGATTATTAACCAAATCTTGGATAAAACTATCACTA
TACCAGAAGTTGAACAAACAGGCAAATGGAAAATCATTAC
GTCATTTCATAAATTCCCAGAATCGACCACAACAGTGGAG
TTTGAGGTCAAAGAATATGTTTTGCCCACATTTGAGGTGA
AGATTGAGGCTTCACAGCCTTATCATATTTTGATGAGCGA
GTCCTTTCCCTTCAACATTTCTGCTAGATATACTTATGGA
AAGGGGGTCAATGGGATTGCATATGTTCGATTTGGACTTG
TTGATGAAAAGCACAATAAGATATATCTTCCAGGCACTGA
AAAGCAGATAACTGTAGAGGACGGCACTGCAGGAACAGCA
GTACTTACTAAAGACTTAAAAACAGCATCACAAAATATCA
CTCAAGGCTATATAGAAGGATATTATATTTATATTGCGGT
CTCAGTTTTGGACAAAGCAAGTGGCATGCTGGAGGAAGCC
GAGAGTTCCTCTGTGAAGATTGTGACATCTCCATATGTTG
TTGATCTGTCAAAAACCAAGACGTATTTCACCCCTGGTGG
TGTATTTTCTGTTTTGGCTACTGCAACTTATCCAGATGGA
AACAGAGCCCCGAACTTGAAATTTACAGCCACCATAACAA
TTGATGGATCATCAGAGCAGATTCTGCAAAACGAAAGCTG
GGGAAATGAAATGGGAGATGTTGCCATGTCTTTTCAAATT
CCACCACAGGCTAAGAACTTAGCTATAACAGTATTTGCTG
AAGGTGGAGACCAAGTCGTAATTCGTAGTGATAATAAGAT
GACTGCCAGTGCAATAACAGCTGAAGAACAGAGCTATCTG
AGTTTGGAAGTAGAGAAACAGTTCTTACAAGCTGGTGAGG
ACTTGAAAGCCAGATTGCGGGACATCACCCCTGAGGGTGC
AGCCAAACCGACTTTCTTTTATTTTATGGTTTGGAGTAAG
GGGCAAATTGTGCAGATGGGGCGGGTGCCAAGAACTGCAT
TCACAACTGTCAATGTGAAAGTTAACGTGGATATGGTGCC
TTCTTTTCGTCTCGTGGCCTACTATTTTACAGGCTCCGCA
TCAAAAGAAAGTGTAGTGGCTGACTCTGTGTGGGTCGATG
TGAAAGATGTCTGCAAAGGCAAGATAGAAATTAATCCGCT
GGCTGAGATAAAACCTGCAACACAGTTTGAGGTGACAGTC
GAGACGAATCCAAAGACCAAAGTGGCTCTTGTGGCGGTGG
ACTCTGCAGTTTATATTCTCAACAAAAACAAACTAAGCCT
TCAAAAGATGTTTGATTATATGAACTCGTATGACCTGGCC
TGCTCTGTTGGAGGAGGAGAGGATTCTAGTGCTGTTCTGC
AGAGAGCCGGGCTGACTTTCATTTGTAACTGTGCTCTTAA
AACCCCTACAGCACTAGAGCATAAGTGTAACAAAAAAACT
ACCAATCGTGTCAGGAGAGCACCGGACTATGTTGCTAAAT
ACAATGCAGTCGTTAACAGCTTTAAGAATCAAGACAGGAA
ATGCTGTTTGGATGGTGTAAGGCCCAGCAAAATGCAAACA
TCCTGTGTTGACCGTCTTAAAAGAGTAAAAGAATCGGAGA
GTTGCCGTAAGGCTTTTAAAGAGTGCTGCGAAGCTGCAGA
TGAGAGGAGGAAAAGGGAGAAGTTTGAGAAGAGAAAAACC
AGCCTTGGAAGAGTTGTTGGTGACTCATTTGATGAAATTG
TGATTAATGAGGATTTGATCTACATCCGTAACTATTTCCC
ACAGTCGTGGATGTGGACAGTCATTGAATCAGATAACAAA
GGCTTAATCAGGCATGAAGTGGTTGCCCCTGATTCCATTA
CCACTTGGGAAGTCCAGGCTGTTGGCATTTCTCCCACTAA
AGGATTTTGCATTGCTGAGCCAAAGCCCTTGACAGTCTTC
AAGGATTTCTTTTTGTCCGTCAACCTTCCTTATTCTGTGA
AGAGAAACGAACAGCTTCAGGTTAAAGCTGTTGTGTACAA
TTACAAGCAGGAGAGTTTAAAGGTAATAGTGAAGCTGAAT
AAGGTGGAGGGTTTGTGCACTGCTGGAGGTAATGATGTGA
AGGAGGAGGTCACAGTTTCTGGTAACTCAGCAGTGACCGT
GTATTTCACTGTGGTGCCCCTTATTATTGGGAACCTCCAC
ATTGATGTTCTAGCTTATGCTTCCGAAATCATCCATGATC
GAGTCGAAAAGAAACTTCGTGTGGAGGGGGAAGGTGAATT
AACCTCTATCGACAGGGAGTTCAACATTGACCCAAATTTG
AAAAAAATAGAGTTTAACATTTCATCCCCTGTTGATGAGG
TCCCTGCTGGTTCAGACTCAGAAACCTCTTTAGGTTTTAA
AGGTGGAGTGATGGGCGAGTCAATAGACAACTGTTTAAAC
CTGGAGGGTATTGATAAACTGATCCAGCTGCCCACTGGCT
GTGCAGAACAGACTATGGTGAAGATGTCTCCCGCTATTCA
TGCCATGAGGTATCTGGATGCCACCAACCAGTGGTTATCT
CTGAAAGCTGAACGCAGAGATGAGGCCCGATCCATGATCC
AAACCGGTTACAACACAGTCCTCACACACAAGAAAGACGA
TGGCTCTTATGGAGCTTTCCTAAGAACTCCTAGCAGTATT
TGGCTTACTGCATTTATTGCCAAAGAGCTGACGGGTTCTC
AGGACATTGTCAATGTGAACAAATTATATATTCAGGAGGC
TATGTCTTATCTCATTTCCAAACAGAAGAGCAATGGTGCA
TGGGATGATCCCAATCGCCTGTTTGACCAAGGAATGAAGG
GAGGAGTAGAACAAGCAACAGATGACGTTCCCCTCACTGC
CTTTGTGCTTATATCAATGCACCATGCTTTGAAAGTTTAC
GATCTGGGAAGTGATACGGAACTGAGAGTAGCTATGGATA
AAGCAAAGTCCTACCTAGAAGCGCAGCTGGATGCTGTGAG
GAGTCCCTATTCACTTGCTGTCACAGCTTATTCCTTTTCC
TTGCATGATCATCGAAGTGCAGAAGCTCGGAAAGCGCAAC
AAAAGCTACAAGACATTGCTAACTGTGATGACAAAATGTG
TTTTTGGAAAGCCAAGGGTGGCAGAGGTGAACCAAAAGAT
AAAGCTGATGCTCGATCAGTGGAGACCACAGCATATGCTC
TGCTCACTACACTCATTGTGGGTGACAAGAGCAAGTCTAA
ACTCATTGCAAACTGGCTGACAGAGCAGCGCAGACACGGT
GGAGGCTTCCGCTCCACACAGGATACAGTTTTGGCCCTTG
AAGCTCTGACAAAATACAGCATACAGAACAATGATGTTGA
CGATCTGAATCTGAGGGTAGAAATGTGCCTTGAAAATGGC
CAAAAAAAAGATTTGCACTTGACCAAAAATAATGCTCTCA
CTCTCTCAGCTGTGAAGGTCAGAGATGTTGGGAAAGTTAC
CCTAAACATTCAGGGAACAGGACGGGGAACATTAGCCGTT
GTGCAGACGTACAGAACTATGAAGAAGGATGAATCATTCT
GTGATCTTTTTCACCTTACTGTCACAGTGAAGGGAGAGCT
GGAGTACAAAACCGACAATAGTCAAGATCTGCTTGAAGAT
TATTATGAGAGCTATGACACCAGTGAAGCTCAAAATGATG
AGCCCATGAGCAACATGCAGTGGTTTGACCTCCGCAGCCG
CAGAAAAAGACAAATCTCGGAGGAGCCGATAAAAGAGAGT
TCTCTCATATACACAGTGTGTGTGGGCCTGAAAAAGAAGA
ACTCTGAGGGCATGATCATAGTGGACATTTCTCTTCTGAG
TGGACTGATACCAAACAGCAAAGACCTGGAACATAATGTA
AAGGGCACAGAGAAGTACATCGATCACTATGAAATTCACC
ACAACAAAGTCTATCTTTATTTTGCAAAGATCACTGAAAC
AGAGGAGTGTCTTCAGTTTGGTGCCGATCAGGCTGTTCCC
ATGGGTCTCGTCCAGCCTGCTTCTGCTGTCATCTATGACT
ATTACAGTCCAGAGAAGAGATGTGGCATTTTCTACACAGC
GCCTCAGAAGAGCCCGATGATCTCCAAACTGTGTCAAGGA
GACGTGTGTACATGTGCAGAAGGTGGTTGTGCGAAGCTGA
AAGTTACCTTCAGCAAGAATATGGAATCCAACAGCAGGAG
TAGTTTTGCTTGTTATGATCCCAGTGTTGACTATGTTTAT
GTGATCAAAATTCTCAGCTCTAGAAGTGATGATGTTTTTA
TGTACTACACTACGCTAATCACTGATGTTCTGCAGACTGG
TAGGACTGGTTTTGACTCTGAAATTCAGAAAGGTGAAACT
CGTCAGATGATCCAACGTTTATCATGTGAGCTGGAGCTGA
AAGATGAAGCCCAGTATCTGCTCATGGGCCATGACAGAGC
AATCTCAGAGCAGAATAACAACAGACAACAAACCAAGTAC
ATACTGAACAGTGACATGTGGATCGAGAAGATACCGGAAG
AGAAGAGGTGCAAGTCGACCACAAGCCGCTCAGCCTGCTT
TCTCCTTACTGAATTTATAAAGCAGCATCCCATTAAAGGC
TGCGACATCTAGACGAGGTCATGCAGATGAGAAATAATCA
CACTGAACGTCTTTGTTTGGCTCTGTAAATCATGTGCTTT
TATTTCTAGTGCATACTGACATAAAGAGACTCTTACAGTT
GTTTGGTACATTGGAAAGTAAGCATTTCAGTTCAGTTTTT
TTTGCATGTGTGTATTGGCAATACAGTAGATTCACATTAC
TCTTCATTCTGTTAGATAAAGGGAGAAATTTAGCTAAATG
GAATACATTTTCATATAGTGACCACAGATTTCTGTCTTTA
TGACATGATCTTTTTATAGTATGATCTCCATGTTAAAACA
TGGGTACTTTTAAGGGGTTGTTTTAGGATGTGTTCACACT
TGACAGGTTTGGTTTGATTAAAACAACAGCTCTGCGTCAG
ACAAACTACTGTACGTTTTGTTTTTAACCTATTCCAAACA
AACTCAAATGTGGTTAGGCTGAAATATGAAAACAAAGATC
TAAACAAATCAAAAACAGGATATGATGTCAGTCTGAAATG
TACATACGGCAAGTGGATTTTGAATGTGTAACCGCAGAAC
AACATGCATCAAAAATGCCTTAAGGTTTAGTCCTAAAGGA
ACAGTTTGTGCAAAAATTAACATTTCCTTACCATTTACTA
ATGTTCAAAACTTGAACATTTCTTCTGTTTGATGACATGA
AACAGAAGAAATGAATTTCATAAATTTCTTCTGTTTGATA
CAAAATAAGATGTTTTGAAACCGATAAAAAAAAGCAGCCA
TTAAAATCTATTCTAACCATATTATGGGCGTCAATGTCAA
ATATCGTGACATATCGCTTGTTTCCCAGAGATGGGTTGCT
GCTGGAAGGGCATCCGCTGTGTAAAGATTTGCTGGATAAG
TTTGCAGTTCATTCCACTGTGGCGACCCCAGATTAATAAA
GGGACTAAGCTAAAAAGAAAATAAATGAATTTTCGCTTGT
GTTGAACAGTTTAAAATAATTCAAACAGGTTTGGAACAAG
TGGATGATTAGTAGTGGTGGGCAAAGAGAGGCTTCATGAA
ACACTGAAAATGTGTTGACTCTTCGAAACCCATTTCTACA
GTGACACCTAGTGGTCATTTATTTATGTATCGCTTTGGAA
CCGCATCAGCAAAGAAACAAGTAAACAAATTAAGGTATTA
ACACGTTGTAGAGTTGAGGCTTCAAGTGGTTAAATTAAGC
TGTGAGAGTTCCTGACTCGCATTCAGAGGTCATGGGTTGA
ATCCAGGGTGATGCAGCTGTAGATGATAGTTTTTAAATGC
TCAGTTATCTTAAGGAGTTTTGTTTTAACGTTGGTCTGAT
ATCCCAATGAATATAGGTCTTGTTTTGGTCAGAAAAAAGT
AGCATTAGTAAAATACATTGTCATAATTTGAGTGTTTGTA
TAAGTCAGGATTTGAACAACTGAACAATTAAAGCACAGTT
ATTTTGTGTACACGCAAACTGTAGGCCACTAGGTTACATG
AGATAGTTTTGTTTATTTTGACCCTGTCAGTCAAACGTGG
ATTTAACAGGTCTCAAAACGCCTCTGAAATGACATGCGTT
AAATCATTTTAGTCACATAACTAGGTGTTTCGAAACACTT
GAGTGTTTCAGATCATGATTGGAAGAACTTGCGCTTCAAT
CTCAAAACAGTTGAAACATCTGTTTCACGTCAGTCATCCC
TAATAATTAGTAAATAATGACTAAGGACTACACCTTTAAA
AGTGACAGTGTTGTGGACACAAAGTGAACCGGGACTACAT
GGATCGCAAGCAAACCAAACTACAAACGTGAACACATCCT
TTAAAAAAACACAGATGCTACATATTCAAGAGTGCATTAT
TGCAGTTTAAGTACTATCTTTATAATGCTTCACATCTCCT
GTAGTTTTACAATGTACAGTTTTATTACAGAATACTGTAT
TTAGTGGCTTAATCAACACTGGCTTTCTAGTTTGTAAAAT
CAAAACTTCATATAAAGTATAAACGCGCTCATGA

c4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA c4-201 7274
c4-202 (1)    Ensembl 611
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
c4-201 Contained in:
[BAC] CH211-162K9 (1)

Genome Resources: Vega_Trans:OTTDART00000057624 (1),  Ensembl_Trans:ENSDART00000028349 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC146727 (1) 2909 bp
GenBank:CN177544 (1) 877 bp
GenBank:EE328669 (1) 835 bp
GenBank:AW116315 (1) 731 bp
GenBank:DN891341 (1) 648 bp
GenBank:AW133972 (1) 645 bp
GenBank:EB881443 (1) 588 bp
GenBank:EB930650 (1) 507 bp
CITATIONS (2)