ZFIN ID: ZDB-TSCRIPT-131113-2774
Transcript Name: ottdart00000057296
Previous Name: ch211-212c13.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057296 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057296|OTTDARG00000039936|ZDB-GENE-041212-59 usp2a|no_translation CH211-212C13.4-001 LG_none CR848784.13,BX548078.9 Danio rerio antisense NOVEL, 791 bp
AGTGTCGATATAGGGCACCAAGGAGAACTTTAGCAAGATA
AAAACATGGACATCAAAGGGGATATTTTAAGTGAAGAGCA
CCAGAGTGCGGGACCACACCACATCCCCGAGAACCCCCAC
ATGTTTCTCTACAGCACGTCCGTCCCTCTTACCGAACGAG
TCCACTGGGATGACCAGCAGGAACAGCAGGCGTCCAGGAG
GAGCCAGCATCACACTGCGCTGGATCTCCTGTTTCACCTG
CCTGCCGTCCGCCAAGCCGAAGAGACTCCAGCCTGGAGTA
TCCACCACAGCCAGCCGCAGGCCGTCCACCCAGCCGAACC
TCCTCACACAGCGGACAGTCTTCTTGCCAGGCTCAAACTC
ACTGCGGCCTAGGATGAGGTCTCCTACTGAGCTCTTACCA
GAATGCCTTCGTCCCAACAGCACAAGTCCCATCACAGAAG
GACTTTCTGGATCCACTTACCATAAAACAAAGAAGCCAAA
TCAGAGCATTTCAGAGATCAGTAGCAGCCACACTGAATAA
AAGTCACGCCACACGCCGTTCTCTCACCACCACAGACTTT
CACAACAAACTCCCGGGACTCGCTCAGGAAGTTGAGAAGA
AAGGGAGCATGGAGAAGAGAACAAAGCATATACACTGAAA
ACATGATGACGGGTGGGAAAGATGATGATGATGGTGGTGA
AAGAACAAGCTGTACTGTAACAGTGCACTTCTGTAACTCT
GCAGCTGCCCGCTAGGGGGCGCCTCGACTCTCAAGACAAA
TACTTAAAAAATTAAATCATGAAGAGAATCC

usp2a TRANSCRIPTS
Type Name Length (bp) Analysis
antisense ottdart00000057296 791
mRNA usp2a-201 (1) 2641
usp2a-202 (1) 434
usp2a-203 (1) 1274
usp2a-204 (1) 665
usp2a-205 (1) 888
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000057296 Contained in:
OTHER ottdart00000057296 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000057296 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH539326 (1) 828bp
    GenBank:EH560517 (1) 798bp
    GenBank:EH555589 (1) 794bp
    GenBank:EH576693 (1) 774bp
    CITATIONS (1)