ZFIN ID: ZDB-TSCRIPT-090929-12058
Transcript Name: usp2a-201
Previous Names: usp2a-001, zgc:92134-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029678 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029678|OTTDARG00000022884|ZDB-GENE-041212-59 usp2a|OTTDARP00000024217 usp2a-001 LG_ BX548078.9 Danio rerio protein_coding KNOWN, 2641 bp
GGGCGGGACGGACAGTAGTGAAAAGAGATGGAGCCGCGCG
CAGCCTCCAGCTTGACAGCTTCACTTCTCAACACACGCTC
GTCTCGTGAAGGATTCGTTTTATACCTTCGCCAGCAACTT
TATTCGTTTTCTGCTGTGTGAAAGTGTGCTGTTTATAGTG
AGTAGATCAGGGCGCAATGTTTTATTCGTCCTCAATGTCG
CGTCGCTCCGCTGTAGAGGTCGTTTCCTGATCAACTTGAA
GGATAATTCTGGATTAAAAAAAGAACGTTGGAGCATTTGA
TGCCAATCGTCCACAGTGTTGATTTCTAAATGCTGGTGTT
TATTCACCACAGAAGGATTCGTTGATTATGCCAAGCATGC
GACATTCATATACAGTGACAATACCAGAGGAGCCACCTGC
GACTGCGCTCTCTCTTCTCAAACAAGACATGAGGAGGAAA
AACTCTGTGTCCGGCTCCATGCTGGTCTCCACATTCGTCG
GGCTTCTTATTAATCATGCCAAGAACTCAAAGAGTGCCCA
GGGCCTGGTCGGGCTTCGTAATCTGGGAAATACATGTTTT
ATGAACTCCATCCTCCAGTGTCTTAGCAACACACAGAGCC
TGCGAGACTACTGTCTTCACAACTCCCACCGCCGAGACCT
CAACAACAACAACCGCACACACACTGCTCTCATGGAAGAG
TTTGCCAAGCTTATCCAGACAATGTGGACTTCCTCAAGCA
GTGAAGCTGTCAGTCCCTCTGAGTTCAAAACACAGATTCA
GAGATACGCCCCCAGATTTGTGGGCTACAATCAACAGGAT
GCTCAGGAGTTTCTACGGTTCCTGCTTGACGGCTTGCACA
ATGAAGTAAACAGGGTCACGGTCCGGCCACGGGGAAACAC
AGAAGATTTTGACCACTTGCCTGATGAAGAAAAAGGGAAA
AAGATGTGGTCTAAGTATTTAGAGAGAGAAGACAGCAAAA
TTGTAGATCTGTTTGTAGGCCAGCTAAAGAGCTCTCTGAC
CTGCAGCGAATGCGGTTATTGTTCCACTGTGTTCGATCCC
TTCTGGGATCTTTCCTTACCTATCGCCAAGGGCTATGGAG
AGGTGAGCCTAATGGACTGCATGCGGCTCTTTACAAAAGA
AGACGTGCTTGATGGGGACGAGAAGCCTACATGTTACAGA
TGCAAAGCCAGACGGCGATGTACGAAGAAATTTACGGTTC
AGAAGTTTCCTAAAATTTTAGTTCTTCATCTGAAACGCTT
CTCAGAAGCCCGCATTCGAACCAGCAAACTGTCTACTTTT
GTCAACTTCCCAATGAAAGACCTGGACCTCAGGGAATTTG
CCTCTGACAGAAGCAGTAGTGCTGTGTATAATCTGTATGC
AGTGTCCAATCACTCAGGCACGACTATGGGAGGCCACTAC
ACAGCATACTGCTGCAATCCTGAAAATGGGGAATGGTACA
CGTATAATGACTCCAGAGTCACGCCAATGTCTGCCAGCCA
AGTTCGCAGTAGCGACGCCTATGTGCTGTTCTACGAGCGA
GCTGGACTCTGAGGACGAACTGTGGACAGGGATAAAGTGC
AGAACTCGAGCCCATAGTCTGAAGACACATTACACACCAC
ACTGCTTGCTCTGGGCCGTAATGCAGAATGATCATCGCTC
TCTGCTGGCCATGAGGGGAAGCGCAAACAAAGCCCTCTCA
CACTCCAGCATTGTTAAAGAGGTGCCTTTGTGAGCGCGTG
TGTGTACGTGTGTGTGTGTGTGTGTGTGTGTGAATATATC
AGGGCGGCTCGTCATCAGGCAATAACCCGGCTCAGACTCG
ATCTCTCTATGCACTGCAACCAAACTCTCATCCCGATGCG
CCTTCCTCTTGATCAAGAACGCCTCAATTATACATGTATA
AAAACAAACTTTGTTCACTTGATTTTTGTTTTGGATTCTC
TTCATGATTTAATTTTTTAAGTATTTGTCTTGAGAGTCGA
GGCGCCCCCTAGCGGGCAGCTGCAGAGTTACAGAAGTGCA
CTGTTACAGTACAGCTTGTTCTTTCACCACCATCATCATC
ATCTTTCCCACCCGTCATCATGTTTTCAGTGTATATGCTT
TGTTCTCTTCTCCATGCTCCCTTTCTTCTCAACTTCCTGA
GCGAGTCCCGGGAGTTTGTTGTGAAAGTCTGTGGTGGTGA
GAGAACGGCGTGTGGCGTGACTTTTATTCAGTGTGGCTGC
TACTGATCTCTGAAATGCTGTGAATGGAAATGCAGATAAG
AGGAGAGATGACGGTGATGCTGACAGTATATGGATCCTTG
ATCTCATGCCATTGAACAACATGGAAAGAATGTTTTGCAA
AAAAAAGAAAAATCTGTATATTTTTATATATGATGCAATA
TAGAGAATGTACTATATACAGTGGTGCTGCAAATGACCCA
TTACTGTTGCCGGTTTATTTAACAGAGGTAAGAGAACATT
ATGCTTACAGGTCAGGAGATAATGTGATGAGTCACACAGT
GGCAGTCAGAGTATAAATATATATATATATATGTATCAAT
AAATTTTAGAAGAATGAGCTGTTTCAATCCTCTCATGAGA
TTGTGTTTTGTCTTTGCTTGTCACTTCATACGAGCTGTTA
AATGAATTAAAAAGAGTATTTAATTTTTGACATTTGGAAA
A

usp2a TRANSCRIPTS
Type Name Length (bp) Analysis
antisense ottdart00000057296 (1) 791
mRNA usp2a-201 2641
usp2a-202 (1) 434
usp2a-203 (1) 1274
usp2a-204 (1) 665
usp2a-205 (1) 888
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
usp2a-201 Contained in:
OTHER usp2a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029678 (1)
  • Ensembl_Trans:ENSDART00000134053 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC086963 (1) 2331bp
    GenBank:EE311200 (1) 903bp
    GenBank:CO931415 (1) 878bp
    GenBank:EE304552 (1) 853bp
    GenBank:CK142527 (1) 741bp
    GenBank:CT700908 (1) 723bp
    GenBank:BI672353 (1) 627bp
    GenBank:EB917176 (1) 582bp
    GenBank:EB852798 (1) 450bp
    CITATIONS (2)