header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-460
Transcript Name: usp2a-205
Previous Name: usp2a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057298 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057298|OTTDARG00000022884|ZDB-GENE-041212-59 usp2a|OTTDARP00000044905 usp2a-002 LG_ BX548078.9 Danio rerio protein_coding KNOWN, 888 bp
CTTCCAAAGCAACACGCTGCCCATGGAAAAAGCTACTGGT
TTGAGCAGTGAACGGTGTTTGTGAGGTATAATGAACCACC
ACCTCTGTTTTTCCGTCCGTTAGAACCGAGAACGGCTCTA
CTTACAAGTCCATGCAGCCTGAAATTGCCTTACGTACGGC
TGAGCACCCAGCATGTCTCGTGTCTCCTCTACGGCGAAGC
GCTACGCCGGTTCGTCTTATACCAGTCACTACAGCTCCTA
TGGCTCCTCCTTGACTCCATCGCTTGGCTCATACGAGCGG
GACAAGCTGCCCTATAAGAGCTCCTCCTCGGGCTTCTCCT
CCTCATCCTCTAGCTACCTAAGCTCAAGTGCCAGCCGCTC
CCGCAACTACAGCTCCAGCTACCTCTCCTCCTCGCCTGTG
TCCTCCAGCATTTCCCTCAGTCGCAGGAAGTCTGTGAGTC
AGAGCGATTTGACGCACGATCTGTCGGCTCTGGGACTGAG
CGAAACCTCTAGTGGCAGTGGCCTAAAGCAGTCCTACCTA
AGCCGAGGCAGTGACGTATCTGACTCCTACAGCAGCTCTC
GCTCCAGCCTAGGCCTCTCACGGAGCTCCACACAGGAGGG
GTTAGGCAGCAGTGGCCTGAAGAGCAGCAGCCGATTCTCC
TCCAGCTATCGCTCCACCTCACCCGTCAGAGAGTCTTTGA
ACTCAAAGAGTGCCCAGGGCCTGGTCGGGCTTCGTAATCT
GGGAAATACATGTTTTATGAACTCCATCCTCCAGTGTCTT
AGCAACACACAGAGCCTGCGAGACTACTGTCTTCACAACT
CCCACCGCCGAGACCTCAACAACAACAACCGCACACACAC
TGCTCTCATGGAAGAGTTTGCCAAGCTTATCCAGACAATG
TGGACTTC

usp2a TRANSCRIPTS
Type Name Length (bp) Analysis
antisense ottdart00000057296 (1) 791
mRNA usp2a-201 (1) 2641
usp2a-202 (1) 434
usp2a-203 (1) 1274
usp2a-204 (1) 665
usp2a-205 888
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
usp2a-205 Contained in:

OTHER usp2a-205 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000057298 (1)
  • Ensembl_Trans:ENSDART00000152648 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN316162 (1) 892 bp
    CITATIONS (2)