header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1460
Transcript Name: ottdart00000059602
Previous Name: ch211-153j24.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059602 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059602|OTTDARG00000041319|ZDB-GENE-031222-4 fosab|no_translation CH211-153J24.7-001 LG_ AL929435.16 Danio rerio antisense NOVEL, 723 bp
GGAAGAGGTCGTGATTGATGTGTTTGGTGTGGAAGAGACC
ACTGAGGTAGTGACGATCTCTGGGACTGAGATGGAGCCCA
TGGGAGAGGAGGACGGCTCTGGGAAGCTGGCGTCGGCCGG
GATCTTGCAGATGGGTTTGTGTGCGGCGAGGATGAACTCT
AACCTCTCTTTTTCTTTGAGCAGGTTGGCGATGTCGTTCT
GCAGGGCGGATTTTTCATCCTCAAGCTGGTCAGTTTCCTG
TTGTGGAACATCAAAGGGTTAGTTTAATGATGTCATGGAT
GGAACGAGCTAGAATGGGATTTGGAGGGAAAATGCAGAAT
ACTTACAGCTTGCAGTGTATCGATCTGCTTCTCTTGTTGG
AGGTCTTTGCTCCAGTAACCCTCATTTTGGGGTAAGAGCT
CGGGTTGTAGGATTGAGCTGCGCCGTTGGAGGGCGCCACA
GAGGAGATCATGGGCTGGACCATCCACTGCAAGTCCGGGC
ATGAAGAGATCGCCGTGACAGTTGGCACGAAAGAGGCACT
TGAGACACTCAGATCCGTGAACTCCTGAAATATAGAATAT
GAAATCGTTTATTATATGATAAACAATATATTTTGATTAG
TCACAAAACTAATATATATACAATTTATTTGTTTATATTA
CTGTTTATGGGGTTTCATTCAGATTATAACATAATACAGA
ACATAATATACTTTAAAAACATAAATAAACTGACTTAAAT
CAT

fosab TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA fosab-201 (1) 1699
fosab-202 (1) 570
antisense ottdart00000059602 723
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000059602 Contained in:

OTHER ottdart00000059602 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000059602 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES No data available
    CITATIONS (1)