header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-901
Transcript Name: fosab-201
Previous Names: fos-001, fosab-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000007033 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000007033|OTTDARG00000006380|ZDB-GENE-031222-4 fosab|OTTDARP00000006258 fos-001 LG_ AL929435.16 Danio rerio protein_coding KNOWN, 1699 bp
AGTCAAACTTTGGATACCAAAACAGAGAAAAGAGCAGCAG
ACGAGCAAGGAAATACAAGACCGGAGCGTTTTTAACTTTC
TGGATATATTAGCGCTGGATAGCTCGTGCTTTTCGACTTT
TGACAGGATGATGTTTACCAGCCTTAACGCCGACTGCGAC
GCGTCTTCCCGGTGCAGCACGGCTTCACCGAGCGGCGACA
GCGTCGGGTATTACCCGCTCAACCAGACTCAGGAGTTCAC
GGATCTGAGTGTCTCAAGTGCCTCTTTCGTGCCAACTGTC
ACGGCGATCTCTTCATGCCCGGACTTGCAGTGGATGGTCC
AGCCCATGATCTCCTCTGTGGCGCCCTCCAACGGCGCAGC
TCAATCCTACAACCCGAGCTCTTACCCCAAAATGAGGGTT
ACTGGAGCAAAGACCTCCAACAAGAGAAGCAGATCTGAAC
AGCTTTCTCCAGAAGAAGAAGAGAAGAAAAGAGTACGTCG
TGAACGAAACAAGATGGCTGCTGCGAAATGCCGCAACCGT
CGACGTGAACTCACCGATACACTGCAAGCTGAAACTGACC
AGCTTGAGGATGAAAAATCCGCCCTGCAGAACGACATCGC
CAACCTGCTCAAAGAAAAAGAGAGGTTAGAGTTCATCCTC
GCCGCACACAAACCCATCTGCAAGATCCCGGCCGACGCCA
GCTTCCCAGAGCCGTCCTCCTCTCCCATGGGCTCCATCTC
AGTCCCAGAGATCGTCACTACCTCAGTGGTCTCTTCCACA
CCAAACACATCAATCACGACCTCTTCCAGCAGCCTGCTGT
TCTCCAGCACGGCCTCCACCGACAGCTTCAGCTCCACCAC
AGTGAAGATCTCTGATCTGGAGCCCACTCTAGAGGAGTCT
CTGGAGCTCCTGGCTAAAGCGGAGCTGGAAACGGCTCGCT
CGGTTCCAGACATGGACCTGTCCAACTCTCTGTACACTCA
AGACTGGGAGCCGCTCTACACGCCGGCTAACACTGACCTG
GAGCCGCTTTGCACACCCGTCGTCACCTGCACTCCAGCCT
GCACCACCTACACGTCTTCCTTCATGTTCACCTACCCAGA
AAACGACGTCTTCCCGACATCAGTGCATCGCAGGGGCAGC
AGCAGCAACGATCAGTCGTCCGACTCCTTGAATTCCCCAA
CCCTCCTCACTCTTTGAGATTCCACTAAAGACTATTAGTA
TTTATATCTGTGACTTGATTTCGAATGGCATTGCAGGGCT
ATGGAAGTGACTCTAAAGCAATGGATATTGCTTCCTATAT
TTATCTGAACCATACATGCCTGCCACATGTAGCAAGATAA
GCATGGATCAACTGATTTTATTTGCATTAATGATCTGGTT
AGTGTTGAGTTAACCTAATATAGTTATTTTTCTGAGTTTA
CCGGTGCTAGATTTGTTGTATTTAGTGTGTTCTGAGCAAT
AGAGAACTATCATGTTATTTTTTTTCGGCCGTTTAACGGT
TGATTTCTGAACGTGTGAATGTTGTTTACTCAAATGTGTG
CTGCCTAACCATTGCATTAAATGGTCTGACGTCCAAGTAT
GAAGTTTTCTGTGAAAACGTAGTCTCTCTTTTAATTTATG
GAGTTTTTATTTTTGTACTGAAATGTGAACTTGCGAATTG
TTTGCAAAAAACAAACAAAAAAAACTAGACACAATAAATA
TTAAATGTATAAACTAAAA

fosab TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA fosab-201 1699
fosab-202 (1) 570
antisense ottdart00000059602 (1) 723
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fosab-201 Contained in:

OTHER fosab-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000007033 (1)
  • Ensembl_Trans:ENSDART00000043298 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA477597 (1) 943 bp
    GenBank:CF265283 (1) 890 bp
    GenBank:CK016297 (1) 880 bp
    GenBank:CK019231 (1) 851 bp
    GenBank:CK127377 (1) 813 bp
    GenBank:CK142327 (1) 811 bp
    GenBank:CK127154 (1) 799 bp
    GenBank:CK141777 (1) 788 bp
    GenBank:CK126544 (1) 787 bp
    GenBank:CF996345 (1) 781 bp
    GenBank:CF347640 (1) 769 bp
    GenBank:CK142281 (1) 699 bp
    GenBank:CF943701 (1) 617 bp
    GenBank:BQ259459 (1) 569 bp
    CITATIONS (2)