header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-902
Transcript Name: fosab-202
Previous Names: fos-002, fosab-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000007034 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000007034|OTTDARG00000006380|ZDB-GENE-031222-4 fosab|OTTDARP00000008496 fos-002 LG_ AL929435.16 Danio rerio protein_coding KNOWN, 570 bp
AGTCAAACTTTGGATACCAAAACAGAGAAAAGAGCAGCAG
ACGAGCAAGGAAATACAAGACCGGAGCGTTTTTAACTTTC
TGGATATATTAGCGCTGGATAGCTCGTGCTTTTCGACTTT
TGACAGGATGATGTTTACCAGCCTTAACGCCGACTGCGAC
GCGTCTTCCCGGTGCAGCACGGCTTCACCGAGCGGCGACA
GCGTCGGGTATTACCCGCTCAACCAGACTCAGGAGTTCAC
GGATCTGAGTGTCTCAAGTGCCTCTTTCGTGCCAACTGTC
ACGGCGATCTCTTCATGCCCGGACTTGCACAAGATAAGCA
TGGATCAACTGATTTTATTTGCATTAATGATCTGGTTAGT
GTTGAGTTAACCTAATATAGTTATTTTTCTGAGTTTACCG
GTGCTAGATTTGTTGTATTTAGTGTGTTCTGAGCAATAGA
GAACTATCATGTTATTTTTTTTCGGCCGTTTAACGGTTGA
TTTCTGAACGTGTGAATGTTGTTTACTCAAATGTGTGCTG
CCTAACCATTGCATTAAATGGTCTGACGTCCAAGTATGAA
GTTTTCTGTG

fosab TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA fosab-201 (1) 1699
fosab-202 570
antisense ottdart00000059602 (1) 723
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fosab-202 Contained in:

OTHER fosab-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000007034 (1)
  • Ensembl_Trans:ENSDART00000060680 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BM957279 (1) 569 bp
    CITATIONS (2)