ZFIN ID: ZDB-TSCRIPT-131113-1414
Transcript Name: il6st-201
Previous Name: il6st-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059410 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059410|OTTDARG00000027608|ZDB-GENE-080104-6 il6st|OTTDARP00000046317 il6st-002 LG_none BX294128.19,BX321872.10 Danio rerio protein_coding KNOWN, 2601 bp
ATGGACACTTCACATCATTGGCTGTTGGTCTTGATGCTCT
TGCATTATGCAAAAGGTTCCAACAGTAGCTGTGTATTAAA
AATTCTTCCAGACTCCAAGACTAAGATTCCTGTTGAGTTG
GAAAGAAACTTCACAGCGACATGCCACCTCCAGGGTGGAT
CTGAATTTACCTCAAATGACATCAAATGGTCTTTTAGCAA
CAAAGAAACTACAGACATTTTATCAAAGACATTTTATCAC
AAAATAAATGAAACCTCCGTCAGTGTTACAGTTAACCTCA
GCAAAAACATGGGTCATATGTTGATGTGTGAAGCCTCCAG
AGAGTCCTTAACATACATGGGAAAATGTGCCTACGGAATC
TACCTTGATGCAGGATACCCTCCGATGAAACCAAAGAATC
TGACATGCATTGCTTTGCAAAGGAAGAAGGATATTTCTCC
TGACCTAAATTGTTATTGGGAACCAGGATTGAGAGACCCA
CTGCTTGCCACCAATTATACTCTTTATGCCCAAGTAGGAC
AAGATTTATATAACAGCACCTGTAAACAGAGTCTTGCAAG
AAGTTGCACCGTCAACCTGAGCACTTATCCTGTTCATATG
ACTTTGAAAGTCTGGGTTGAAGTGAAAAATTCACTGGGGT
CAGAACGGTCAGACGAACACGAGTACGATTCCTTGAGTCT
TGTGAAACCAAATCCACCAAATGTCGAAGTTAAAGTTGAA
GAGGACTTCCCTACATCTTTTGTGGTTAAATGGGAGTATG
ACATTGAAGACACAACTATGCGATTCTCCAGTGCCATTAG
ATACTGCCAAGTAGGGTCAAGTGATTGGAAAAAGGTGCCT
GAGAACTACACCAATGTGCACATTACGTCGTATCGACTGC
AGTCCCTAGAGCCTTACACTGAGTATGTGGTACAGATGCG
ATCCATCGGAGAGCACTACACCATCTGGAGTGAATGGAGC
TCCAATGTTACAGTTCGCACTCCAGAAGCCAGGGAATTCC
CACTGCCATTTTTGAAGTGCGTTGCACTTTGTGAAGTGGT
CAATGCAAGTTTATATGAACAGACCCTTGACCTGTCAATT
TTGACTAAGCCTCCTGTGAAAGCTAATGGAAAAATGTGTA
ACTATTCCCTGATCATCAGTCAAGATAACCAGGCTTTTGA
AAGTCACGTTATAAAAGCTGATCAGCTCAACCAGAGGTAT
TCACTGGAAGTGCCACCAGAAGAAAATGCCAGTATTGAAA
TAACTGCATTCAATTCAGCCGGAGGGTCTCCCAAAACTAT
TTTGTTCATTCCAAGATCAAATGACGAGTTTCTTGGCGTG
GCGAGCATGAGGTGGTGGGTTCATGATGGAAAGCTTCATG
TGGAATGGGGTCCTTTGAAGCAGCATCCTCCTCATGGCAT
TCATATCTCAGAATATCTGCTGGAGTGGGTGAATGAAAAA
GATGTTCAGCCTCAGTGGCAGAGGGTTCCTAAAAATGTCA
ACACCACCATACTGAACGGTAATTTAGCCAAATACAAGCA
GTACAACATATCAGTCTATCCAATCTACAAGTTCTATTAT
GATGGTCGATGGCATTTCCAAGCAGGAACACCAGTAACCA
AGCCAGCCTACGTTCAGCAAGGAGCACCAGAGAAAGGCCC
TACTGTCACAGATACCATTTCCAAGAAAAATAGTGTTACA
CTGATATGGGAGGAAATTCCACTGGACCACCGGTATGGAT
TCATCCAAAACTACACCATATTCTACAGGACCGGCAACGC
TGAGTGGCAATCTGTGCTAGTGGCCGCTAACATCCACTCG
TATGTATTGACTGATCTGGTCAGTGAACGCGACTATGTGG
TTCACATCATGGCCTCGACGGAAGCTGGCTCCAAAAACGG
CACCGATTTTAATTTCAAAACAATGAAGTTCGCCGATGGA
GAGGTGGAGATGATTGTAGTGCTGGTGTGCCTCGGCTTCC
TGTTCCTGAGCGTCTTCACCATAATGCTCTGCCTTCGCAA
GAGAGAAGTGATTAAGAAGCTGTTATGGCCGCAAGTCCCG
GATCCGTCTGACAGCTCTATTGCCCACTGGTCACCTGATT
TCCCTGTAAAGACCGAAATGCCCAAGGAAGACGTCAGCGT
GGTGGAAGTGGACGTGTTTGACGGCAAGTCTTTGTGCGAA
GAAGATAAAGTTGTTCTGCCGCTAAAGAAGGACAAGTACC
TCTCCGAGGAGCACAGCAGCGGTATTGGAGGCTCGTCCTG
CATGTCTTCGCCCCGCCACAGTGTTTCCGACAGCGATGAG
GGCGACTCGGGCCAGACCACGGCCAGCACCGTCCAGTACT
CGTCAGTGGTGGCCAGCGGATACAAGGGCCAAACCCCAAA
CCATCAGCCTCCAACGTTCGCCCGCTCCGAGTCCACACAA
CCGCTGCTGGACTGCGAGGAGCATCCAGAGAATCATCCCG
GCGAGAGGAACTCTTACTTTAGACGGGGCCGAGAGCTGGA
GCCGCAGAGTATCGATGAGCCTGTTTTCAGCGCGGTGCAG
GAGGAAGAAGCATCTCCCGTTGTGGATGATGCGCCGGCGT
TAAGTTACATGCCGCAGCAGAGCGGGTATCGACCGCAGTA
A

il6st TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA il6st-201 2601
il6st-202 (1)    Ensembl 8300
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
il6st-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000059410 (1),  Ensembl_Trans:ENSDART00000161903 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)